Tubuca coarctata

(H.Milne Edwards, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Ocypodidae/Tubuca

At a glance

Occurrence records926

Data sources6

Biological traits3

DNA specimens24

eDNA detections24

Sources6 archives

Databases and archives Tubuca coarctata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility837 records↗

OBISOcean Biodiversity Information System89 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF · OBIS926 records

Environmental DNA1 datasets · 3 countries24 detections

DNA & barcodingBOLD24 specimens

01Narrative

Uca (Tubuca) coarctata is een krabbensoort uit de familie van de Ocypodidae. De wetenschappelijke naam van de soort werd in 1852 voor het eerst geldig gepubliceerd door Henri Milne-Edwards.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tubuca coarctata has left across the world's sequence archives.

At a glance

DNA specimens24

BINs2

Marker genes1

eDNA detections24

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P616 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

8Cmostly conserved

25Amostly conserved

31Amostly conserved

61Cmostly conserved

85Amostly conserved

94Cmostly conserved

97Tmostly conserved

139Gvariable

163Amostly conserved

193Tmostly conserved

226Cmostly conserved

229Avariable

232Gmostly conserved

241Tmostly conserved

242Tmostly conserved

247Tmostly conserved

286Amostly conserved

298Cmostly conserved

304Cmostly conserved

307Amostly conserved

310Cmostly conserved

313Amostly conserved

358Amostly conserved

361Amostly conserved

365Cmostly conserved

376Amostly conserved

406Gmostly conserved

421Cmostly conserved

523Amostly conserved

526Tmostly conserved

535Amostly conserved

556Tmostly conserved

592Tmostly conserved

595Tmostly conserved

TACATCACTAAGATTAATTATTCGAGCAGAATTAAGTCAACCAGGTAGACTTATTGGTAACGATCAAATCTACAATGTTGTAGTAACAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes13

BINs2

Most divergent pair6.0%

OtherAsiaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tubuca typhonisame genus9.7%Tubuca arcuatasame genus9.9%Tubuca forcipatasame genus10.1%Paraleptuca crassipessame family11.2%Tubuca capricornissame genus11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type926 records

Wild obs. + sensor673

Museum / vouchered253

Range

Area of Occupancy AOO1 112 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 1 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 289≤1 km 145≤10 km 33>10 km 18

485 georeferenced · 188 without coordinates

Open the mapobservation + sensor673

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 12≤1 km 67≤10 km 10>10 km 2

91 georeferenced · 162 without coordinates

Open the institutions mapphysical evidence253

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	63
Sydney, AU	53
Western Australian Museumlocation not on record	17
Kyiv, UA	12
Washington, US	9
	6
Brussels, BE	3
RBINS-Scientific Heritagelocation not on record	1

8 institutions · 164 of 253 vouchered records shown · 1 without an institution code

09Environmental DNA24 detections

Where the DNA of Tubuca coarctata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.4–22.6

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C 24.6–28.5

Min temp (night)15.0 °C 15.0–18.9

Precipitation15.6 mm/mo 15.6–386

Air humidity43.4 % 43.4–64.8

Moisture balance-143 mm/mo -143–253

Vapour deficit1,624 Pa 928–1,624

Wind speed4.00 m/s 1.20–4.00

Cloud cover18.1 % 18.1–46.6

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)