Tubuca dussumieri

(H.Milne Edwards, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Ocypodidae/Tubuca

At a glance

Occurrence records395

Data sources6

Biological traits3

DNA specimens32

eDNA detections32

Sources6 archives

Databases and archives Tubuca dussumieri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility325 records↗

OBISOcean Biodiversity Information System70 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF · OBIS395 records

Environmental DNA1 datasets · 3 countries32 detections

DNA & barcodingBOLD32 specimens

01Narrative

Uca (Tubuca) dussumieri is een krabbensoort uit de familie van de Ocypodidae. De wetenschappelijke naam van de soort werd in 1852 voor het eerst geldig gepubliceerd door Henri Milne-Edwards.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tubuca dussumieri has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

eDNA detections32

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P616 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

25Amostly conserved

34Gmostly conserved

TACATCTCTAAGATTAATTATTCGAGCGGAACTGAGTCAACCCGGAAGACTTATTGGAAACGATCAAATTTACAATGTAGTAGTAACAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.26%

Haplotypes8

BIN1

Most divergent pair2.8%

AsiaOceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tubuca typhonisame genus9.7%Tubuca capricornissame genus10.2%Tubuca roseasame genus11.0%Tubuca paradussumierisame genus11.0%Tubuca longidigitumsame genus11.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type395 records

Wild obs. + sensor243

Museum / vouchered140

Other12

Range

Area of Occupancy AOO676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 126≤1 km 34≤10 km 6>10 km 10

176 georeferenced · 67 without coordinates

Open the mapobservation + sensor243

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 8≤1 km 20≤10 km 18

46 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence140

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	39
Natick, US	17
	14
Washington, US	13
Kyiv, UA	7
Paris, FR	3
CASlocation not on record	1

7 institutions · 94 of 140 vouchered records shown · 1 without an institution code

09Environmental DNA32 detections

Where the DNA of Tubuca dussumieri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 19.7–25.9

Seasonal swing summer↔winter6.10 °C

Max temp (day)25.7 °C 22.7–27.0

Min temp (night)20.2 °C 15.8–24.7

Precipitation328 mm/mo 189–354

Air humidity63.5 % 62.2–65.3

Moisture balance229 mm/mo

Vapour deficit1,073 Pa 815–1,228

Wind speed1.60 m/s

Cloud cover42.1 % 38.4–46.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)