Silurus lithophilus

(Tomoda, 1961) · species

image placeholder — illustration coming later

Animalia/Chordata/Siluriformes/Siluridae/Silurus

At a glance

Occurrence records3

Data sources7

Biological traits5

DNA specimens6

eDNA detections2

Sources7 archives

Databases and archives Silurus lithophilus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF3 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD6 specimens

01Narrative

Silurus lithophilus is een straalvinnige vissensoort uit de familie van de echte meervallen (Siluridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1961 door Tomoda.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length58 cm

Body mass1 500 g

Habitat & environment2

Habitat freshwateryes

Habitat zonedemersal

Other traits1

Vulnerability43.2

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Silurus lithophilus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P617 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

282Tvariable

603Amostly conserved

GGTGCCTGAGCCGGAATAGTCGGCACAGCTTTAAGTCTCCTAATCCGAGCAGAGCTGGCCCAACCCGGCGCCCTCCTAGGCGATGATCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes4

BIN1

Most divergent pair0.32%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Silurus asotussame genus5.2%Silurus soldatovisame genus5.2%Silurus biwaensissame genus6.0%Silurus aristotelissame genus6.3%Silurus meridionalissame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 records

Museum / vouchered3

Range

Area of Occupancy AOO12 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence3

10Collections & institutions

Institution	Specimens
CASlocation not on record	1
Kagoshima University Museumlocation not on record	1
Gifu prefectural Museumlocation not on record	1

3 institutions · 3 of 3 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Silurus lithophilus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)