Silurus biwaensis

(Tomoda, 1961) · species

image placeholder — illustration coming later

Animalia/Chordata/Siluriformes/Siluridae/Silurus

At a glance

Occurrence records1

Data sources7

Biological traits5

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Silurus biwaensis's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF1 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Silurus biwaensis, the giant Lake Biwa catfish or Biwako-o'namazu (ビワコオオナマズ (Japan)), is a large predatory catfish species endemic to Lake Biwa in Japan.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length118 cm

Body mass17 200 g

Habitat & environment2

Habitat freshwateryes

Habitat zonedemersal

Other traits1

Vulnerability70.8

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Silurus biwaensis has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P617 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

21Cvariable

615Cvariable

GGTGCCTGAGCCGGAATAGTCGGCACAGCTTTAAGTCTCCTAATCCGAGCAGAGCTGGCCCAACCTGGCGCCCTCCTAGGTGATGATCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.22%

Haplotypes3

BIN1

Most divergent pair0.32%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Silurus lithophilussame genus6.0%Silurus soldatovisame genus6.5%Silurus aristotelissame genus6.5%Silurus asotussame genus6.8%Silurus meridionalissame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 records

Museum / vouchered1

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

10Collections & institutions

Institution	Specimens
Gifu prefectural Museumlocation not on record	1

1 institutions · 1 of 1 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Silurus biwaensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–7.40

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C

Min temp (night)3.00 °C

Precipitation344 mm/mo

Air humidity64.9 %

Moisture balance263 mm/mo

Vapour deficit428 Pa

Wind speed2.90 m/s

Cloud cover44.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)