Silurus aristotelis

Garman, 1890 · species

image placeholder — illustration coming later

Animalia/Chordata/Siluriformes/Siluridae/Silurus

At a glance

Occurrence records15

Data sources10

Biological traits0

DNA specimens12

eDNA detections10

Sources10 archives

Databases and archives Silurus aristotelis's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD12 specimens

Genome at a glanceGoaT · NCBI≈800 Mbp

01Narrative

Aristotle's catfish (Silurus aristotelis) is a species of fish in the family Siluridae. It is endemic to Greece, where it occurs in the Acheloos River drainage. Its natural habitat is freshwater lakes. It is threatened by habitat loss. This species grows to a length of 46 cm TL and is of importance to local commercial fisheries. It is known from Lake Trichonida, Lake Lysimachia and Lake Amvrakia and introduced to Lake Volvi and Lake Ioannina in the 1980s thus exclusively lives in lakes. Threats may be water pollution and overfishing. Its name derives from the fact that it was first described by Aristotle in his History of Animals.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Silurus aristotelis has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes2

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.93%

Haplotypes2

BINs2

Most divergent pair2.0%

Where individuals differ — all 13 variable positions, in barcode order

8Cvariable

10Avariable

13Avariable

17Gvariable

21Cvariable

22Cvariable

31Avariable

32Avariable

34Avariable

35Gvariable

36Tvariable

41Avariable

51Gvariable

CCTTTACCTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACAGCTTTAAGTCTCCTAATCCGAGCAGAGCTAGCCCAACCTGGCGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Silurus lithophilussame genus6.3%Silurus biwaensissame genus6.5%Silurus meridionalissame genus7.4%Silurus soldatovisame genus7.4%Silurus asotussame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12S

animal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Silurus aristotelis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈800 101 988 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Silurus aristotelis0.80 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness96.9% BUSCO

08Occurrence & distribution

Record type15 records

Museum / vouchered11

Other4

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence11

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1

2 institutions · 2 of 11 vouchered records shown · 9 without an institution code

09Environmental DNA10 detections

Where the DNA of Silurus aristotelis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.3 °C 10.2–15.3

Seasonal swing summer↔winter18.5 °C

Max temp (day)19.3 °C 14.1–19.3

Min temp (night)9.80 °C 4.40–9.90

Precipitation49.9 mm/mo 33.9–53.3

Air humidity55.7 % 55.7–59.8

Moisture balance-51.8 mm/mo -51.8–-34.3

Vapour deficit878 Pa 505–878

Wind speed3.00 m/s 1.80–3.00

Cloud cover35.2 % 35.2–42.2

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)