Sesamia inferens

(Walker, 1856) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Sesamia

At a glance

Occurrence records298

Data sources9

Biological traits0

DNA specimens253

eDNA detections231

Sources9 archives

Databases and archives Sesamia inferens's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility298 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI231 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics253 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF298 records

Environmental DNA1 datasets · 4 countries231 detections

DNA & barcodingBOLD253 specimens

Genome at a glanceGoaT · NCBI≈964 Mbp

01Narrative

Sesamia inferens, the Asiatic pink stem borer, gramineous stem borer, pink borer, pink rice borer, pink rice stem borer, pink stem borer, purple borer, purple stem borer or purplish stem borer, is a moth of the family Noctuidae. The species was first described by Francis Walker in 1856. It is found from Pakistan, India, Sri Lanka, Myanmar to Japan and the Solomon Islands."Asiatic pink stem borer". PaDIL. Australian Government Department of Agriculture. Retrieved 22 January 2019. A polyphagous species, it is a major pest in many crops worldwide.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding253 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sesamia inferens has left across the world's sequence archives.

At a glance

DNA specimens253

BINs15

Marker genes12

eDNA detections231

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P438 bp consensus237 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 39 variable positions, in barcode order

8Amostly conserved

11Tmostly conserved

74Tmostly conserved

94Cmostly conserved

104Amostly conserved

113Gmostly conserved

137Tmostly conserved

140Cvariable

144Gmostly conserved

162Tvariable

173Tvariable

176Cmostly conserved

188Tmostly conserved

209Amostly conserved

236Cvariable

246Tvariable

253Gmostly conserved

254Tmostly conserved

260Tmostly conserved

266Tmostly conserved

275Tvariable

276Cvariable

284Tvariable

308Tmostly conserved

318Tmostly conserved

332Amostly conserved

341Amostly conserved

347Tvariable

357Tvariable

359Avariable

371Tvariable

389Tvariable

392Cmostly conserved

395Cvariable

401Amostly conserved

404Amostly conserved

407Tmostly conserved

410Cvariable

422Cvariable

ATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTATTACCCCCCTCTTTAACTCTTTTAATTTCAAGTAGAATTGTAGAAAATG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.9%

Haplotypes19

BINs15

Most divergent pair12.1%

AsiaOtherAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sesamia grisescenssame genus5.3%Argyrospila succineasame family5.3%Platypolia contadinasame family6.0%Apamea devastatorsame family6.0%Apamea monoglyphasame family6.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2COIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodefungal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_015835 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Sesamia inferens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈963 664 144 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sesamia inferens0.96 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type298 records

Wild obs. + sensor74

Museum / vouchered224

Range

Area of Occupancy AOO568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 18≤1 km 4≤10 km 3>10 km 3

28 georeferenced · 46 without coordinates

Open the mapobservation + sensor74

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 21≤1 km 1

22 georeferenced · 202 without coordinates

Open the institutions mapphysical evidence224

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	54
Chiba, JP	39
Hiwa Museum of Natural Historylocation not on record	21
tesrilocation not on record	18
Iwate Prefectural Museumlocation not on record	4
JP	4
KOMlocation not on record	4
ANGRAU, S. V. Agricultural College, Tirupati, Andhra Pradesh & ICAR-IIRR, Hyderabad, Indialocation not on record	3
ANGRAU, S. V. Agricultural college, Tirupati, A.P.& ICAR-IIRR, Hyderabad, Indialocation not on record	2
Central Rice Research Institutelocation not on record	2
The University of the West Indies, Trinidad and Tobagolocation not on record	2
Taiwan Forestry Research Institutelocation not on record	2

12 institutions · 155 of 224 vouchered records shown · 67 without an institution code

09Environmental DNA231 detections

Where the DNA of Sesamia inferens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found231

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 231 detections have coordinates

Open the map4 countries0

RiceMaize14. Artificial - Terrestrial|14.5 Urban AreasCorn

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 22.2–29.7

Seasonal swing summer↔winter20.8 °C

Max temp (day)30.5 °C 23.6–34.9

Min temp (night)19.6 °C 15.4–25.1

Precipitation109 mm/mo 18.3–167

Air humidity58.8 % 52.0–62.4

Moisture balance-17.8 mm/mo

Vapour deficit1,373 Pa 1,012–1,710

Wind speed2.60 m/s

Cloud cover26.3 % 11.5–37.2

CHELSA 1981–2010, ~9 km grid, at location & month of 61 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)