Semioscopis packardella

Clemens, 1863 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Semioscopis

At a glance

Occurrence records883

Data sources7

Biological traits0

DNA specimens40

eDNA detections42

Sources7 archives

Databases and archives Semioscopis packardella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility883 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF883 records

Environmental DNA1 datasets · 2 countries42 detections

DNA & barcodingBOLD40 specimens

01Narrative

Semioscopis packardella, also called Packard's concealer moth or Packard's flatbody moth, is a species of moth of the family Depressariidae. It was described by James Brackenridge Clemens in 1863. It is found in North America in central Alberta, southern Quebec, Manitoba, California, Idaho and Oregon and from New Jersey to Ohio. The wingspan is 10-13.5 mm. The forewings are brown with a distinct black band in the discal cell region. Adults are on wing from April to May.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Semioscopis packardella has left across the world's sequence archives.

At a glance

DNA specimens40

BINs2

Marker genes1

eDNA detections42

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

157Cmostly conserved

202Amostly conserved

235Tvariable

271Cmostly conserved

274Cmostly conserved

463Cmostly conserved

511Gmostly conserved

529Cmostly conserved

628Amostly conserved

640Cmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGTTTATCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes12

BINs2

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Semioscopis merriccellasame genus3.5%Semioscopis strigulanasame genus4.4%Semioscopis megamicrellasame genus4.6%Semioscopis avellanellasame genus4.7%Semioscopis mcdunnoughisame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type883 records

Wild obs. + sensor694

Museum / vouchered189

Range

Area of Occupancy AOO1 672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 401≤1 km 71≤10 km 24>10 km 47

543 georeferenced · 151 without coordinates

Open the mapobservation + sensor694

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 1≤1 km 23≤10 km 29>10 km 1

54 georeferenced · 135 without coordinates

Open the institutions mapphysical evidence189

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	59
East Lansing, US	18
Cornell University Insect Collectionlocation not on record	15
UNHClocation not on record	15
University of Guelph, Centre for Biodiversity Genomicslocation not on record	12
Cambridge, US	11
Royal Saskatchewan Museumlocation not on record	10
New Haven, US	8
Mississippi State, US	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
St. Paul, US	3
SOVTlocation not on record	2
Philadelphia, US	1
Vernal, US	1
Decorah, US	1
Colorado State Universitylocation not on record	1
Saint John, CA	1

17 institutions · 166 of 189 vouchered records shown · 23 without an institution code

09Environmental DNA42 detections

Where the DNA of Semioscopis packardella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map2 countries0

1. Forest & WoodlandForestTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 6.60–19.1

Seasonal swing summer↔winter26.1 °C

Max temp (day)16.4 °C 11.0–24.1

Min temp (night)7.40 °C 1.50–15.1

Precipitation86.2 mm/mo 74.0–116

Air humidity56.6 % 54.8–61.2

Moisture balance-11.2 mm/mo -46.4–50.6

Vapour deficit592 Pa 412–865

Wind speed3.20 m/s 2.80–4.00

Cloud cover47.9 % 38.5–50.4

CHELSA 1981–2010, ~9 km grid, at location & month of 38 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)