Semioscopis megamicrella

Dyar, 1902 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Semioscopis

At a glance

Occurrence records333

Data sources7

Biological traits0

DNA specimens45

eDNA detections44

Sources7 archives

Databases and archives Semioscopis megamicrella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility333 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI44 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF333 records

Environmental DNA1 datasets · 2 countries44 detections

DNA & barcodingBOLD45 specimens

01Narrative

Semioscopis megamicrella is a species of moth of the family Depressariidae. It was described by Harrison Gray Dyar Jr. in 1902. It is found in the northern United States and southern Canada. The wingspan is 15–25 mm. The forewings are pale brown to dark grayish brown with fine speckling. The hindwings are pale grayish brown. Adults are on wing from April to May.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Semioscopis megamicrella has left across the world's sequence archives.

At a glance

DNA specimens45

BINs1

Marker genes1

eDNA detections44

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

59Cvariable

223Avariable

247Cmostly conserved

364Cvariable

400Cmostly conserved

403Avariable

418Tmostly conserved

539Tmostly conserved

581Cmostly conserved

613Cvariable

TACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGTTTATCTTTAAGACTACTAATTCGTGCTGAATTAGGTAATCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.56%

Haplotypes10

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Semioscopis avellanellasame genus4.1%Semioscopis strigulanasame genus4.4%Semioscopis packardellasame genus4.6%Semioscopis mcdunnoughisame genus4.9%Semioscopis aurorellasame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type333 records

Wild obs. + sensor167

Museum / vouchered166

Range

Area of Occupancy AOO620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 95≤1 km 14≤10 km 8>10 km 20

137 georeferenced · 30 without coordinates

Open the mapobservation + sensor167

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤1 km 7≤10 km 14>10 km 1

22 georeferenced · 144 without coordinates

Open the institutions mapphysical evidence166

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	62
Washington, US	13
New Haven, US	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
Royal Saskatchewan Museumlocation not on record	10
UNHClocation not on record	5
Cambridge, US	4
East Lansing, US	4
Smithsonian Institution, National Museum of Natural Historylocation not on record	4
St. Paul, US	3
San Francisco, US	2
Mississippi State, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1

14 institutions · 132 of 166 vouchered records shown · 34 without an institution code

09Environmental DNA44 detections

Where the DNA of Semioscopis megamicrella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found44

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 44 detections have coordinates

Open the map2 countries0

Temperate mixed forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.80 °C 5.60–11.3

Seasonal swing summer↔winter29.0 °C

Max temp (day)12.1 °C 11.1–16.4

Min temp (night)1.60 °C 0.7–6.40

Precipitation75.0 mm/mo 62.9–90.7

Air humidity55.3 % 54.8–56.1

Moisture balance-11.0 mm/mo -24.1–7.90

Vapour deficit445 Pa 413–587

Wind speed4.00 m/s 3.00–4.00

Cloud cover47.9 % 47.4–51.8

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)