Semioscopis aurorella

Dyar, 1902 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Semioscopis

At a glance

Occurrence records645

Data sources7

Biological traits0

DNA specimens62

eDNA detections67

Sources7 archives

Databases and archives Semioscopis aurorella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility645 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI67 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics62 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF645 records

Environmental DNA1 datasets · 2 countries67 detections

DNA & barcodingBOLD62 specimens

01Narrative

Semioscopis aurorella, the aurora flatbody moth, is a species of moth of the family Depressariidae. It was described by Harrison Gray Dyar Jr. in 1902. It is found in Canada from north-central Alberta to south-eastern Ontario, south into the United States between south-central New York and Wisconsin. The length of the forewings is 11–14 mm. The colouration of the forewings is variable and ranges from yellow grey to pale yellow white.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding62 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Semioscopis aurorella has left across the world's sequence archives.

At a glance

DNA specimens62

BINs1

Marker genes1

eDNA detections67

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus56 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

628Amostly conserved

CACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGATTATCTTTAAGATTACTAATTCGTGCTGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes5

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Semioscopis mcdunnoughisame genus2.3%Semioscopis megamicrellasame genus5.0%Semioscopis strigulanasame genus5.0%Semioscopis avellanellasame genus5.5%Semioscopis packardellasame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type645 records

Wild obs. + sensor403

Museum / vouchered242

Range

Area of Occupancy AOO972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 280≤1 km 31≤10 km 13>10 km 21

345 georeferenced · 58 without coordinates

Open the mapobservation + sensor403

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤1 km 39≤10 km 27>10 km 1

67 georeferenced · 175 without coordinates

Open the institutions mapphysical evidence242

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	75
University of Guelph, Centre for Biodiversity Genomicslocation not on record	31
East Lansing, US	28
New Haven, US	21
Washington, US	9
Cambridge, US	8
UNHClocation not on record	8
St. Paul, US	5
Smithsonian Institution, National Museum of Natural Historylocation not on record	3
Royal Saskatchewan Museumlocation not on record	3
Mississippi State, US	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Universidad Católica de Manizaleslocation not on record	1
SOVTlocation not on record	1

14 institutions · 196 of 242 vouchered records shown · 46 without an institution code

09Environmental DNA67 detections

Where the DNA of Semioscopis aurorella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found67

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 67 detections have coordinates

Open the map2 countries0

ForestGrasslandTemperate mixed forest5. Wetlands (inland)|5.4. Bogs, Marshes, Swa…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.80 °C 5.10–7.00

Seasonal swing summer↔winter26.1 °C

Max temp (day)12.2 °C 10.0–12.4

Min temp (night)1.80 °C 0.7–3.70

Precipitation75.0 mm/mo 65.8–96.8

Air humidity54.8 % 54.8–58.0

Moisture balance-11.0 mm/mo -18.3–4.00

Vapour deficit448 Pa 408–454

Wind speed4.00 m/s 3.30–4.60

Cloud cover47.9 % 46.0–50.1

CHELSA 1981–2010, ~9 km grid, at location & month of 60 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)