Semioscopis merriccella

Dyar, 1902 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Semioscopis

At a glance

Occurrence records226

Data sources7

Biological traits0

DNA specimens18

eDNA detections18

Sources7 archives

Databases and archives Semioscopis merriccella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility226 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF226 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD18 specimens

01Narrative

Semioscopis merriccella is a species of moth of the family Depressariidae. It was described by Harrison Gray Dyar Jr. in 1902. It is found throughout the northern United States and southern Canada from the east to the west coast. The length of the forewings is 11–15 mm. The forewings are brown with a black band in the basal anterior region. Adults are on wing from mid-March to the end of May. There is probably one generation per year.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Semioscopis merriccella has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

32Gmostly conserved

34Amostly conserved

39Tmostly conserved

40Cmostly conserved

85Tmostly conserved

235Tmostly conserved

241Gmostly conserved

337Amostly conserved

364Cmostly conserved

490Tmostly conserved

550Amostly conserved

562Avariable

577Gmostly conserved

616Tmostly conserved

625Amostly conserved

646Cmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTCGGTTTATCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.61%

Haplotypes6

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Semioscopis packardellasame genus3.5%Semioscopis avellanellasame genus5.5%Semioscopis steinkellnerianasame genus5.6%Semioscopis strigulanasame genus5.8%Semioscopis megamicrellasame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type226 records

Wild obs. + sensor150

Museum / vouchered76

Range

Area of Occupancy AOO488 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 80≤1 km 15≤10 km 15>10 km 6

116 georeferenced · 34 without coordinates

Open the mapobservation + sensor150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 1≤1 km 34≤10 km 9>10 km 2

46 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	32
University of Alberta Museums (UAM)location not on record	12
New Haven, US	9
Cambridge, US	6
Washington, US	5
Mississippi State, US	3
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

8 institutions · 70 of 76 vouchered records shown · 6 without an institution code

09Environmental DNA18 detections

Where the DNA of Semioscopis merriccella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.60 °C 4.20–17.4

Seasonal swing summer↔winter28.1 °C

Max temp (day)12.0 °C 10.1–22.7

Min temp (night)1.20 °C -1.20–11.7

Precipitation70.4 mm/mo 62.9–110

Air humidity56.4 % 55.3–59.1

Moisture balance-18.1 mm/mo -44.3–58.4

Vapour deficit436 Pa 350–809

Wind speed3.20 m/s 2.90–3.40

Cloud cover47.7 % 41.4–50.1

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)