Schizocerella pilicornis

(Holmgren) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Argidae/Schizocerella

At a glance

Occurrence records1 107

Data sources7

Biological traits0

DNA specimens15

eDNA detections21

Sources7 archives

Databases and archives Schizocerella pilicornis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 107 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 107 records

Environmental DNA1 datasets · 5 countries21 detections

DNA & barcodingBOLD15 specimens

01Narrative

Schizocerella pilicornis, commonly known as the purslane sawfly or portulaca sawfly, is a species of sawfly in the family Argidae. The larva is a leaf miner on Common Purslane.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Schizocerella pilicornis has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections21

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 77% of positions are identical in every specimen.

Diversity (π)4.0%

Haplotypes2

BIN1

Most divergent pair5.8%

Where individuals differ — all 150 variable positions, in barcode order

22Tmostly conserved

44Tmostly conserved

52Cmostly conserved

103Tmostly conserved

127Amostly conserved

130Amostly conserved

181Gmostly conserved

193Cmostly conserved

200Amostly conserved

206Cmostly conserved

217Tmostly conserved

220Tmostly conserved

226Cmostly conserved

238Tmostly conserved

265Gmostly conserved

274Amostly conserved

287Cmostly conserved

343Tmostly conserved

358Cmostly conserved

364Tmostly conserved

386Tmostly conserved

418Tmostly conserved

427Cmostly conserved

430Amostly conserved

433Gmostly conserved

463Cmostly conserved

472Cmostly conserved

476Gmostly conserved

477Gmostly conserved

478Amostly conserved

479Amostly conserved

480Tmostly conserved

483Gmostly conserved

484Amostly conserved

485Tmostly conserved

486Tmostly conserved

487Tmostly conserved

488Gmostly conserved

489Amostly conserved

491Amostly conserved

493Amostly conserved

495Tmostly conserved

497Tmostly conserved

498Cmostly conserved

499Tmostly conserved

501Tmostly conserved

502Amostly conserved

505Tmostly conserved

507Cmostly conserved

510Gmostly conserved

511Amostly conserved

512Gmostly conserved

513Cmostly conserved

514Tmostly conserved

516Tmostly conserved

517Amostly conserved

519Gmostly conserved

520Tmostly conserved

521Amostly conserved

522Tmostly conserved

523Cmostly conserved

525Cmostly conserved

526Amostly conserved

527Gmostly conserved

530Cmostly conserved

531Tmostly conserved

533Tmostly conserved

539Cmostly conserved

541Tmostly conserved

544Gmostly conserved

545Tmostly conserved

546Cmostly conserved

547Amostly conserved

549Tmostly conserved

551Cmostly conserved

552Cmostly conserved

553Tmostly conserved

554Gmostly conserved

555Tmostly conserved

556Amostly conserved

557Tmostly conserved

560Gmostly conserved

561Cmostly conserved

562Amostly conserved

564Gmostly conserved

565Amostly conserved

567Cmostly conserved

568Tmostly conserved

569Amostly conserved

570Tmostly conserved

573Cmostly conserved

576Tmostly conserved

577Amostly conserved

578Tmostly conserved

581Cmostly conserved

583Tmostly conserved

584Amostly conserved

585Cmostly conserved

586Amostly conserved

587Gmostly conserved

588Amostly conserved

589Tmostly conserved

590Cmostly conserved

591Gmostly conserved

592Amostly conserved

593Amostly conserved

594Amostly conserved

595Cmostly conserved

596Tmostly conserved

597Tmostly conserved

598Amostly conserved

599Amostly conserved

600Amostly conserved

601Tmostly conserved

603Cmostly conserved

605Tmostly conserved

607Amostly conserved

609Tmostly conserved

610Tmostly conserved

614Gmostly conserved

+30 more variable positions not shown

AACATTATATTTTTTATTTGGTATTTGATCAGGAATAATAGGATTATCATTCAGAATAATTATTCGAACAGAATTAAGATCAGTAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ptenos leucopodasame family13.1%Durgoa mattogrossensissame family13.5%Aprosthema melanurumsame family14.6%Aprosthema fusicornesame family15.0%Arge ustulatasame family15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 107 records

Wild obs. + sensor185

Museum / vouchered922

Origin

Native7

Range

Area of Occupancy AOO1 532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 92≤1 km 18≤10 km 4>10 km 21

135 georeferenced · 50 without coordinates

Open the mapobservation + sensor185

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 10≤1 km 122≤10 km 547>10 km 6

685 georeferenced · 237 without coordinates

Open the institutions mapphysical evidence922

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	661
OSUClocation not on record	124
WIlocation not on record	39
DPIlocation not on record	14
ASUlocation not on record	13
Vancouver, CA	9
Chicago, US	8
Cleveland Museum of Natural History, OH (CLEV)location not on record	8
Philadelphia, US	7
Sydney, AU	7
University of Central Floridalocation not on record	4
US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
LULlocation not on record	3
Lubbock, US	2
Instituto de Fitosanidad, Colegio de Postgraduados, Campus Montecillolocation not on record	2
Stockholm, SE	1
Cornell University Insect Collectionlocation not on record	1
ZMAAlocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1

20 institutions · 912 of 922 vouchered records shown · 10 without an institution code

09Environmental DNA21 detections

Where the DNA of Schizocerella pilicornis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map5 countries0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 4.00–21.5

Seasonal swing summer↔winter26.4 °C

Max temp (day)22.2 °C 8.30–27.1

Min temp (night)14.0 °C -1.00–16.7

Precipitation81.0 mm/mo 63.0–104

Air humidity60.7 % 56.1–61.4

Moisture balance-48.2 mm/mo -85.4–56.7

Vapour deficit816 Pa 362–1,132

Wind speed2.70 m/s 2.50–3.50

Cloud cover42.5 % 28.0–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Schizocerella pilicornis

At a glance

Sources7 archives

At a glance

Record type1 107 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 107 records