Aprosthema melanurum

(Klug, 1814) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Argidae/Aprosthema

At a glance

Occurrence records94

Data sources6

Biological traits0

DNA specimens6

eDNA detections2

Sources6 archives

Databases and archives Aprosthema melanurum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility94 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF94 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD6 specimens

01Narrative

Aprosthema melanurum is een vliesvleugelig insect uit de familie van de Argidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1814 door Klug.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aprosthema melanurum has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes2

BINs2

Most divergent pair2.1%

Where individuals differ — all 14 variable positions, in barcode order

85Tvariable

199Gvariable

208Gvariable

244Gvariable

343Avariable

367Cvariable

430Avariable

457Cvariable

568Avariable

589Tvariable

613Tvariable

616Tvariable

628Gvariable

652Tvariable

AACATTATATTTTTTATTTGGAATTTGATCAGGAATAATTGGATTATCTTTTAGAATAATTATTCGAACAGAATTAAGATCAGTTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aprosthema fusicornesame genus9.9%Thrinax dubitatasame order14.0%Arge cyrasame family14.6%Schizocerella pilicornissame family14.6%Pristiphora nigellasame order16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type94 records

Wild obs. + sensor36

Museum / vouchered54

Other4

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 7≤1 km 17≤10 km 10

34 georeferenced · 2 without coordinates

Open the mapobservation + sensor36

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 11≤1 km 14≤10 km 21

46 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence54

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	12
Institute of Zoology Slovak Academy of Scienceslocation not on record	7
Oulu, FI	5
MZLUlocation not on record	3
BioFokuslocation not on record	2
Zürich, CH	2
neflocation not on record	2
ZSMlocation not on record	1
Helsinki, FI	1
NHMOlocation not on record	1
Tilburg, NL	1

11 institutions · 37 of 54 vouchered records shown · 17 without an institution code

09Environmental DNA2 detections

Where the DNA of Aprosthema melanurum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 15.1–16.7

Seasonal swing summer↔winter24.3 °C

Max temp (day)19.7 °C 18.7–20.7

Min temp (night)11.5 °C 10.7–12.3

Precipitation75.9 mm/mo 70.2–81.5

Air humidity58.7 % 57.9–59.5

Moisture balance-38.7 mm/mo -40.9–-36.5

Vapour deficit754 Pa 732–776

Wind speed2.50 m/s 2.40–2.60

Cloud cover43.0 % 41.6–44.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)