Psallus perrisi

(Mulsant & Rey, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Psallus

At a glance

Occurrence records1 296

Data sources7

Biological traits0

DNA specimens26

eDNA detections2

Sources7 archives

Databases and archives Psallus perrisi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 296 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 296 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD26 specimens

01Narrative

Psallus perrisi is a Palearctic species of true bug.Mamaev B.M. , Medvedev L.N. , Pravdin F.N. Keys to insects of the European part of the USSR. - M .: Education, 1976 .-- P. 87 .-- 304 p. Ekkehard Wachmann, Albert Melber, Jürgen Deckert: . Wanzen. Band 2: Cimicomorpha: Microphysidae (Flechtenwanzen), Miridae (Weichwanzen) (= Die Tierwelt Deutschlands und der angrenzenden Meeresteile nach ihren Merkmalen und nach ihrer Lebensweise. 75. Teil). Goecke & Evers, Keltern 2006, .

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psallus perrisi has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes1

eDNA detections2

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

196Gmostly conserved

271Tvariable

328Tmostly conserved

337Tmostly conserved

340Cvariable

355Amostly conserved

467Cmostly conserved

530Cmostly conserved

550Amostly conserved

577Gmostly conserved

CACTCTATATTTTTTATTTGGAATATGAGCAGGAATATTAGGCACATCATTAAGATGAATTATCCGAATCGAACTAGGAATACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.39%

Haplotypes6

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Psallus montanussame genus9.3%Psallus betuletisame genus9.3%Psallus varianssame genus9.7%Psallus graminicolasame genus10.0%Psallus variabilissame genus10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 296 records

Wild obs. + sensor987

Museum / vouchered267

Other42

Range

Area of Occupancy AOO3 032 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 339≤1 km 243≤10 km 296>10 km 4

882 georeferenced · 105 without coordinates

Open the mapobservation + sensor987

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 94≤1 km 57≤10 km 24

175 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence267

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	55
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	30
Philadelphia, US	27
SLU Artdatabankenlocation not on record	21
Natural History Museum, Aarhus Denmarklocation not on record	18
Bonn, DE	7
neflocation not on record	7
Metsähallituslocation not on record	6
ZSMlocation not on record	5
ZMAAlocation not on record	3
Tallinn, EE	2
BioFokuslocation not on record	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
NTNU, University Museumlocation not on record	2
Tartu, EE	1
Bavarian State Collection of Zoologylocation not on record	1

16 institutions · 189 of 267 vouchered records shown · 78 without an institution code

09Environmental DNA2 detections

Where the DNA of Psallus perrisi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.3 °C 13.4–15.1

Seasonal swing summer↔winter18.2 °C

Max temp (day)17.9 °C 17.5–18.3

Min temp (night)9.70 °C 8.50–10.9

Precipitation75.8 mm/mo 72.4–79.2

Air humidity58.2 % 57.5–58.9

Moisture balance-39.4 mm/mo -45.5–-33.4

Vapour deficit684 Pa 633–734

Wind speed3.00 m/s 2.40–3.60

Cloud cover38.8 % 34.4–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Psallus perrisi

At a glance

Sources7 archives

At a glance

Record type1 296 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 296 records