Psallus varians

(Herrich-Schaeffer, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Psallus

At a glance

Occurrence records2 209

Data sources9

Biological traits0

DNA specimens110

eDNA detections512

Sources9 archives

Databases and archives Psallus varians's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 209 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI512 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics110 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 209 records

Environmental DNA4 datasets · 11 countries512 detections

DNA & barcodingBOLD110 specimens

Genome at a glanceGoaT · NCBI≈682 Mbp

01Narrative

Psallus varians is a Palearctic species of true bug.Mamaev B.M. , Medvedev L.N. , Pravdin F.N. Keys to insects of the European part of the USSR. - M .: Education, 1976 .-- P. 87 .-- 304 p.Ekkehard Wachmann, Albert Melber, Jürgen Deckert: . Wanzen. Band 2: Cimicomorpha: Microphysidae (Flechtenwanzen), Miridae (Weichwanzen) (= Die Tierwelt Deutschlands und der angrenzenden Meeresteile nach ihren Merkmalen und nach ihrer Lebensweise. 75. Teil). Goecke & Evers, Keltern 2006, .

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding110 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psallus varians has left across the world's sequence archives.

At a glance

DNA specimens110

BINs4

Marker genes1

eDNA detections512

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus103 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

1Amostly conserved

180Gmostly conserved

237Cmostly conserved

279Tmostly conserved

289Gmostly conserved

336Amostly conserved

507Tmostly conserved

576Gvariable

624Amostly conserved

633Cmostly conserved

645Cvariable

ACTCTATATTTTTTATTTGGAATATGAGCAGGAATATTAGGCACATCACTAAGATGAATTATTCGAATCGAATTAGGTATACCAGGATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes14

BINs4

Most divergent pair15.2%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Psallus wagnerisame genus9.7%Psallus perrisisame genus9.7%Psallus graminicolasame genus9.9%Psallus betuletisame genus10.4%Psallus montanussame genus10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Psallus varians carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈682 311 289 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Psallus varians0.68 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.8% BUSCO

08Occurrence & distribution

Record type2 209 records

Wild obs. + sensor1 945

Museum / vouchered257

Other7

Range

Area of Occupancy AOO5 356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 672≤1 km 384≤10 km 717>10 km 20

1 793 georeferenced · 152 without coordinates

Open the mapobservation + sensor1 945

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 91≤1 km 71≤10 km 62

224 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence257

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	35
SLU Artdatabankenlocation not on record	30
NCMGlocation not on record	29
CBDClocation not on record	27
Natural History Museum, Aarhus Denmarklocation not on record	25
Metsähallituslocation not on record	7
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	5
Tromsø, NO	5
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	5
ZSMlocation not on record	4
ZMAAlocation not on record	4
BioFokuslocation not on record	3
Tallinn, EE	2
WGSlocation not on record	2
DFlocation not on record	2
Natural History Museum, Londonlocation not on record	2
South Kensington, GB	2
neflocation not on record	2
Helsinki, FI	1
CIBIOlocation not on record	1
UO-CeStuBiolocation not on record	1
Norwegian Institute of Bioeconomy Researchlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

23 institutions · 196 of 257 vouchered records shown · 61 without an institution code

09Environmental DNA512 detections

Where the DNA of Psallus varians was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found512

Studies independent surveys4

Countries11

Verifiable raw sequence linked408

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 512 detections have coordinates

Open the map11 countries0

Urban area14. Artificial - Terrestrial | 14.2 Pasturel…1. Forest|1.4. Forest - TemperateUrban1. Forest & Woodland|1.4. Temperate Forest1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 10.1–15.0

Seasonal swing summer↔winter17.5 °C

Max temp (day)17.0 °C 13.8–19.2

Min temp (night)9.20 °C 6.10–11.6

Precipitation56.4 mm/mo 34.5–79.6

Air humidity59.2 % 57.3–61.1

Moisture balance-56.7 mm/mo -88.5–-22.6

Vapour deficit610 Pa 497–704

Wind speed3.30 m/s 2.50–4.30

Cloud cover40.1 % 37.8–49.5

CHELSA 1981–2010, ~9 km grid, at location & month of 509 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Psallus varians

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 209 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 209 records