Psallus variabilis

(Fallen, 1807) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Psallus

At a glance

Occurrence records946

Data sources7

Biological traits0

DNA specimens21

eDNA detections104

Sources7 archives

Databases and archives Psallus variabilis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility946 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI104 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF946 records

Environmental DNA3 datasets · 5 countries104 detections

DNA & barcodingBOLD21 specimens

01Narrative

Psallus variabilis is a species of plant bug in the family Miridae. It is found in the Palearctic and as an adventive species in North America. It feeds on the sap of a variety of forest trees including Quercus, plum and crab apple trees and on rose, raspberry and cranberry.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psallus variabilis has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes1

eDNA detections104

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 94 variable positions, in barcode order

4Cmostly conserved

5Cmostly conserved

10Tmostly conserved

13Tmostly conserved

19Tmostly conserved

28Gmostly conserved

34Amostly conserved

40Amostly conserved

49Cmostly conserved

61Cmostly conserved

64Cmostly conserved

79Amostly conserved

85Gmostly conserved

88Gmostly conserved

97Tmostly conserved

103Tmostly conserved

106Cmostly conserved

118Cmostly conserved

121Amostly conserved

133Amostly conserved

136Cmostly conserved

145Cmostly conserved

157Cmostly conserved

163Amostly conserved

169Tmostly conserved

187Cmostly conserved

190Amostly conserved

193Tmostly conserved

205Cmostly conserved

220Cmostly conserved

223Cmostly conserved

235Cmostly conserved

247Cmostly conserved

250Tmostly conserved

263Cmostly conserved

271Gmostly conserved

278Amostly conserved

280Cmostly conserved

286Cmostly conserved

290Gmostly conserved

325Tmostly conserved

337Amostly conserved

340Tvariable

343Gmostly conserved

364Cmostly conserved

367Tmostly conserved

373Gmostly conserved

385Tmostly conserved

386Tmostly conserved

388Amostly conserved

394Tmostly conserved

397Cmostly conserved

403Amostly conserved

407Tmostly conserved

418Amostly conserved

424Amostly conserved

427Cmostly conserved

430Cmostly conserved

433Gmostly conserved

442Tmostly conserved

448Tmostly conserved

463Tmostly conserved

469Amostly conserved

472Tmostly conserved

473Amostly conserved

474Amostly conserved

475Amostly conserved

478Amostly conserved

499Amostly conserved

500Tmostly conserved

508Tmostly conserved

514Gmostly conserved

530Cmostly conserved

539Cmostly conserved

544Tmostly conserved

547Amostly conserved

550Cmostly conserved

562Tmostly conserved

565Gmostly conserved

568Amostly conserved

581Cmostly conserved

586Amostly conserved

598Tmostly conserved

601Cmostly conserved

604Amostly conserved

607Amostly conserved

619Cmostly conserved

622Tmostly conserved

625Gmostly conserved

628Avariable

631Amostly conserved

637Tmostly conserved

640Cmostly conserved

658Cmostly conserved

CACCCTATATTTTTTATTTGGAATATGGGCAGGAATATTAGGCACATCCCTAAGATGAATCATCCGAATCGAATTAGGAATACCGGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes5

BINs2

Most divergent pair14.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Psallus wagnerisame genus10.0%Psallus perrisisame genus10.0%Psallus montanussame genus10.7%Psallus confusussame genus10.8%Psallus betuletisame genus11.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type946 records

Wild obs. + sensor497

Museum / vouchered308

Other141

Range

Area of Occupancy AOO1 932 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 207≤1 km 127≤10 km 94>10 km 25

453 georeferenced · 44 without coordinates

Open the mapobservation + sensor497

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 69≤1 km 107≤10 km 49>10 km 1

226 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence308

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NCMGlocation not on record	67
Philadelphia, US	36
CBDClocation not on record	20
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	20
Natural History Museum, Aarhus Denmarklocation not on record	19
SLU Artdatabankenlocation not on record	15
Bonn, DE	13
Tartu, EE	12
Metsähallituslocation not on record	7
ZMAAlocation not on record	6
NHMOlocation not on record	4
ZSMlocation not on record	2
Tallinn, EE	1
Tromsø, NO	1
Ugentlocation not on record	1
Jyväskylä, FI	1
neflocation not on record	1

17 institutions · 226 of 308 vouchered records shown · 82 without an institution code

09Environmental DNA104 detections

Where the DNA of Psallus variabilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found104

Studies independent surveys3

Countries5

Verifiable raw sequence linked60

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 104 detections have coordinates

Open the map5 countries0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 8.60–15.7

Seasonal swing summer↔winter17.5 °C

Max temp (day)17.6 °C 12.5–20.0

Min temp (night)9.20 °C 4.30–11.9

Precipitation62.0 mm/mo 48.6–95.0

Air humidity59.8 % 58.0–61.2

Moisture balance-40.3 mm/mo -58.5–0.8

Vapour deficit623 Pa 447–732

Wind speed2.60 m/s 2.20–4.30

Cloud cover41.6 % 35.3–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 95 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)