Pomacea paludosa

(Say, 1829) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Architaenioglossa/Ampullariidae/Pomacea

At a glance

Occurrence records1 848

Data sources10

Biological traits2

DNA specimens13

eDNA detections13

Sources10 archives

Databases and archives Pomacea paludosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 848 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.60 Gbp↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 848 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD13 specimens

Genome at a glanceGoaT597 Mbp

01Narrative

Pomacea paludosa, common name the Florida applesnail, is a species of freshwater snail with an operculum, an aquatic gastropod mollusk in the family Ampullariidae, the apple snails.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pomacea paludosa has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes2

eDNA detections13

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P521 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CTAGGGGATGATCAACTTTATAACGTCATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTTTAGTTATGCCCATAATAATTGGTGGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pomacea occultasame genus11.7%Pomacea maculatasame genus12.1%Pomacea canaliculatasame genus13.1%Alia carinatasame order14.2%Turricula javanasame order15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Pomacea paludosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size596 580 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pomacea paludosa0.60 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type1 848 records

Wild obs. + sensor847

Museum / vouchered898

Fossil99

Other4

Origin

Native1

Range

Area of Occupancy AOO3 932 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 364≤1 km 114≤10 km 46>10 km 47

571 georeferenced · 276 without coordinates

Open the mapobservation + sensor847

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 5≤1 km 125≤10 km 100>10 km 43

273 georeferenced · 625 without coordinates

Open the institutions mapphysical evidence898

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
North Carolina Museum of Natural Scienceslocation not on record	143
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	138
Philadelphia, US	133
Cambridge, US	121
Ann Arbor, US	103
Delaware Museum of Nature and Sciencelocation not on record	103
Chicago, US	68
Washington, US	19
Chongqing Museumlocation not on record	12
Champaign, US	12
Montgomery, US	11
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	6
New Haven, US	5
RBINS-Scientific Heritagelocation not on record	3
Brussels, BE	3
Denver, US	3
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
EL PASO, US	2
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	1
Chicago, US	1
Provincia di Livornolocation not on record	1
Paleontological Research Institutionlocation not on record	1
Toronto, CA	1
Akita Prefectural Museumlocation not on record	1

24 institutions · 893 of 898 vouchered records shown · 5 without an institution code

09Environmental DNA13 detections

Where the DNA of Pomacea paludosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

Beach

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.90 °C 9.90–9.90

Seasonal swing summer↔winter25.5 °C

Max temp (day)16.1 °C

Min temp (night)4.00 °C

Precipitation63.8 mm/mo

Air humidity56.3 %

Moisture balance-66.5 mm/mo

Vapour deficit533 Pa

Wind speed3.20 m/s

Cloud cover36.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pomacea paludosa

At a glance

Sources10 archives

Habitat & environment2

At a glance

Genome sizehow big the whole instruction manual is

Record type1 848 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 848 records