Pomacea canaliculata

(Lamarck, 1822) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Architaenioglossa/Ampullariidae/Pomacea

At a glance

Occurrence records3 533

Data sources12

Biological traits2

DNA specimens2 766

eDNA detections2 739

Sources12 archives

Databases and archives Pomacea canaliculata's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 533 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 739 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 766 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionNPASS5 compounds

Occurrence & distributionGBIF3 533 records

Environmental DNA1 datasets · 8 countries2 739 detections

DNA & barcodingBOLD2 766 specimens

Genome at a glanceGoaT · NCBI≈447 Mbp

01Narrative

Pomacea canaliculata, commonly known as the golden apple snail or the channeled apple snail, is a species of large freshwater snail with gills and an operculum, an aquatic gastropod mollusc in the family Ampullariidae, the apple snails. South American in origin, this species is considered to be in the top 100 of the "World's Worst Invasive Alien Species".100 of the World's Worst Invasive Alien Species. Global Invasive Species Database http://www.issg.org/database, accessed 27 October 2008. It is also ranked as the 40th worst alien species in Europe and the worst alien species of gastropod in Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthic

03Chemical composition5 compounds

Compounds documented for Pomacea canaliculata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Iridoids monoterpenoids5

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
[(1S,4aR,5S,7aS)-5-hydroxy-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,7a-tetrahydrocyclopenta[c]pyran-7-yl]methyl (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	NPASS
[(1S,4aR,5S,7aS)-7-(hydroxymethyl)-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,7a-tetrahydrocyclopenta[c]pyran-5-yl] (E)-3-(4-hydroxyphenyl)prop-2-enoate	present	NPASS
Aucubin	present	NPASS
Eurostoside	present	NPASS
Mussaenosidic acid	present	NPASS

05DNA & barcoding2 766 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pomacea canaliculata has left across the world's sequence archives.

At a glance

DNA specimens2 766

BINs6

Marker genes14

eDNA detections2 739

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P600 bp consensus2 600 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

16Tvariable

25Cvariable

43Gvariable

49Tvariable

52Avariable

70Amostly conserved

76Tvariable

91Tvariable

167Tvariable

169Gvariable

172Gvariable

175Amostly conserved

178Amostly conserved

182Tvariable

220Cvariable

251Tmostly conserved

257Cvariable

274Tvariable

310Cvariable

313Tvariable

346Tmostly conserved

382Avariable

385Tvariable

403Avariable

406Avariable

442Avariable

481Gvariable

508Gvariable

511Tvariable

520Gvariable

523Gvariable

550Avariable

586Tvariable

595Tvariable

598Gvariable

AGGCCTAGTTGGGGCTGGTTTAAGCTTACTTATTCGTGCTGAGTTAGGTCAACCTGGTGCTTTACTAGGAGATGATCAGCTTTATAATGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes39

BINs5

Most divergent pair10.7%

AsiaOtherS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pomacea occultasame genus8.8%Pomacea maculatasame genus9.7%Pomacea paludosasame genus13.1%Filopaludina polygrammasame order16.0%Hastula strigilatasame order16.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS118S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodefungal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_024586 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1COX2ATP8ATP6ND1ND6CYTBND4LND4ND5COX3ND3ND2s-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Pomacea canaliculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈447 042 816 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pomacea canaliculata0.45 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness96.4% BUSCO

08Occurrence & distribution

Record type3 533 records

Wild obs. + sensor2 239

Museum / vouchered1 025

Cultivated / captive10

Other259

Range

Area of Occupancy AOO7 756 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 885≤1 km 326≤10 km 83>10 km 38

1 332 georeferenced · 907 without coordinates

Open the mapobservation + sensor2 239

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 21≤1 km 18≤10 km 73>10 km 27

139 georeferenced · 886 without coordinates

Open the institutions mapphysical evidence1 025

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the mapnot free-living10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
INBIOSURlocation not on record	515
PUC-RSlocation not on record	91
fcnym.unlp.edu.arlocation not on record	47
Cambridge, US	29
Buenos Aires, AR	27
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	23
Toyohashi Museum Of Natural Historylocation not on record	17
Philadelphia, US	16
North Carolina Museum of Natural Scienceslocation not on record	13
Ann Arbor, US	11
Washington, US	10
Los Angeles, US	8
Gifu prefectural Museumlocation not on record	7
Natural History Museum Rotterdamlocation not on record	7
Denver, US	6
Tomioka, JP	5
RBINS-Scientific Heritagelocation not on record	4
Delaware Museum of Nature and Sciencelocation not on record	4
Chongqing Museumlocation not on record	4
UFMSlocation not on record	4
Museum and Art Gallery of the Northern Territorylocation not on record	4
Auckland, NZ	3
Chicago, US	3
Champaign, US	3
Salzburg, AT	3
Brussels, BE	2
Sydney, AU	2
KSNHMlocation not on record	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
Santa Barbara Museum of Natural Historylocation not on record	2
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	2
Wakayama Prefectural Museum of Natural Historylocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	1
New Haven, US	1
Natural History Museum of Utahlocation not on record	1
Stockholm, SE	1
Universidad Católica del Nortelocation not on record	1
Toronto, CA	1
DPIlocation not on record	1

39 institutions · 885 of 1 025 vouchered records shown · 123 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 739 detections

Where the DNA of Pomacea canaliculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2 739

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 739 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 10.0–28.5

Seasonal swing summer↔winter23.9 °C

Max temp (day)22.2 °C 15.7–31.9

Min temp (night)14.0 °C 3.10–24.8

Precipitation85.1 mm/mo 13.8–312

Air humidity58.3 % 45.7–64.9

Moisture balance-49.9 mm/mo -95.2–165

Vapour deficit875 Pa 827–1,461

Wind speed3.80 m/s 2.30–4.50

Cloud cover38.3 % 24.1–54.0

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pomacea canaliculata

At a glance

Sources12 archives

Habitat & environment2

Compound class profile1 class

Documented compounds5 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 533 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 39 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 533 records