Pomacea maculata

Perry, 1810 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Architaenioglossa/Ampullariidae/Pomacea

At a glance

Occurrence records5 346

Data sources9

Biological traits0

DNA specimens270

eDNA detections56

Sources9 archives

Databases and archives Pomacea maculata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 346 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI56 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics270 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 346 records

Environmental DNA1 datasets · 1 countries56 detections

DNA & barcodingBOLD270 specimens

Genome at a glanceGoaT · NCBI≈445 Mbp

01Narrative

Pomacea maculata is a species of large freshwater snail with an operculum, an aquatic gastropod mollusk in the family Ampullariidae, the apple snails. Common name of its synonymous name Pomacea insularum is the island applesnail. Together with Pomacea canaliculata it is the most invasive species of the family Ampullariidae. It is considered as about the 58th the worst alien species in Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding270 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pomacea maculata has left across the world's sequence archives.

At a glance

DNA specimens270

BINs6

Marker genes12

eDNA detections56

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus257 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 39 variable positions, in barcode order

12Cmostly conserved

51Amostly conserved

54Cmostly conserved

57Amostly conserved

147Gmostly conserved

153Cmostly conserved

165Gmostly conserved

168Tmostly conserved

192Tmostly conserved

219Tmostly conserved

228Amostly conserved

258Cmostly conserved

270Gmostly conserved

277Tmostly conserved

291Gmostly conserved

294Amostly conserved

318Cmostly conserved

324Gmostly conserved

327Amostly conserved

330Gmostly conserved

336Amostly conserved

375Tmostly conserved

405Cmostly conserved

411Gmostly conserved

441Tmostly conserved

471Gmostly conserved

474Amostly conserved

498Tmostly conserved

501Gmostly conserved

510Amostly conserved

513Gmostly conserved

531Tmostly conserved

567Cmostly conserved

573Tmostly conserved

582Amostly conserved

594Cmostly conserved

597Tmostly conserved

615Cmostly conserved

624Amostly conserved

ACTCTTTATATCTTATTTGGAGTATGATCAGGTTTAGTTGGGGCTGGTTTAAGCTTACTTATTCGTGCTGAGTTAGGGCAACCCGGTGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes21

BINs6

Most divergent pair11.3%

AsiaOtherS.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pomacea occultasame genus5.5%Pomacea canaliculatasame genus9.7%Pomacea paludosasame genus12.1%Laevilacunaria antarcticasame order15.0%Laevilacunaria pumiliosame order15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16SCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_027503 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1COX2ATP8ATP6ND1ND6CYTBND4LND4ND5COX3ND3ND2small subunit ribosomal RNAlarge subunit ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Pomacea maculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈445 128 466 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pomacea maculata0.45 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness79% BUSCO

08Occurrence & distribution

Record type5 346 records

Wild obs. + sensor3 053

Museum / vouchered107

Other2 186

Range

Area of Occupancy AOO7 776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 1 715≤1 km 448≤10 km 145>10 km 81

2 389 georeferenced · 664 without coordinates

Open the mapobservation + sensor3 053

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 2≤1 km 6≤10 km 12>10 km 19

39 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence107

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	18
Cambridge, US	15
Brussels, BE	7
RBINS-Scientific Heritagelocation not on record	6
Washington, US	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	4
North Carolina Museum of Natural Scienceslocation not on record	4
Ann Arbor, US	4
Delaware Museum of Nature and Sciencelocation not on record	3
Chongqing Museumlocation not on record	3
Denver, US	2
Auckland, NZ	2
Barcelona, ES	1
Museu de Ciencies Naturals de Barcelona, Zoological Collectionslocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1
Museum and Art Gallery of the Northern Territorylocation not on record	1
Champaign, US	1
Natural History Museum Rotterdamlocation not on record	1
fcnym.unlp.edu.arlocation not on record	1
Saint John, CA	1

21 institutions · 86 of 107 vouchered records shown · 21 without an institution code

09Environmental DNA56 detections

Where the DNA of Pomacea maculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found56

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 56 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 15.9–15.9

Seasonal swing summer↔winter15.7 °C

Max temp (day)21.8 °C

Min temp (night)11.5 °C

Precipitation66.4 mm/mo

Air humidity54.7 %

Moisture balance-49.9 mm/mo

Vapour deficit875 Pa

Wind speed3.80 m/s

Cloud cover27.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pomacea maculata

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 346 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 346 records