Nemapogon auropulvella

(Chambers, 1873) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Nemapogon

At a glance

Occurrence records78

Data sources7

Biological traits0

DNA specimens40

eDNA detections33

Sources7 archives

Databases and archives Nemapogon auropulvella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility78 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF78 records

Environmental DNA1 datasets · 2 countries33 detections

DNA & barcodingBOLD40 specimens

01Narrative

Nemapogon auropulvella is a moth of the family Tineidae. It is found in North America, where it has been recorded from Florida, Illinois, Indiana, Maine, Manitoba, Maryland, Minnesota, Ohio, Ontario, Quebec, Tennessee, West Virginia and Wisconsin.mothphotographersgroup The forewings are snowy white, dusted with pale reddish or brownish golden.Chambers, V.T. 1873. Micro-Lepidoptera. The Canadian Entomologist, 5(5): 90 Adults have been recorded on wing from May to September. Larvae have been recorded feeding on fungi and detritus.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nemapogon auropulvella has left across the world's sequence archives.

At a glance

DNA specimens40

BINs6

Marker genes1

eDNA detections33

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

181Gvariable

193Cmostly conserved

217Amostly conserved

292Amostly conserved

304Gmostly conserved

317Gmostly conserved

328Amostly conserved

352Tmostly conserved

355Tmostly conserved

379Amostly conserved

397Cmostly conserved

400Cmostly conserved

401Cmostly conserved

403Cmostly conserved

424Tmostly conserved

433Amostly conserved

469Gvariable

481Amostly conserved

487Amostly conserved

499Amostly conserved

514Tmostly conserved

539Tmostly conserved

547Cmostly conserved

562Tmostly conserved

568Tmostly conserved

578Cmostly conserved

595Tmostly conserved

616Tmostly conserved

619Tmostly conserved

622Amostly conserved

641Tmostly conserved

643Amostly conserved

646Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCTAGAATAATCGGTACCTCTTTAAGAATCTTAATTCGAACAGAATTAAGAAGTCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes14

BINs6

Most divergent pair8.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nemapogon ophrionellasame genus6.4%Nemapogon acapnopennellasame genus6.7%Nemapogon hungaricussame genus7.2%Nemaxera betulinellasame family7.3%Nemapogon geniculatellasame genus7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type78 records

Wild obs. + sensor46

Museum / vouchered32

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 27≤1 km 7≤10 km 3>10 km 5

42 georeferenced · 4 without coordinates

Open the mapobservation + sensor46

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1>10 km 3

4 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
St. Paul, US	3
East Lansing, US	2
Cornell University Insect Collectionlocation not on record	2
Cambridge, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1

7 institutions · 24 of 32 vouchered records shown · 8 without an institution code

09Environmental DNA33 detections

Where the DNA of Nemapogon auropulvella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Temperate ForestForeston wood shed, daytime14. Artificial - Terrestrial|14.1 Arable Land

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 16.1–21.0

Seasonal swing summer↔winter31.1 °C

Max temp (day)22.8 °C 21.0–25.7

Min temp (night)14.2 °C 11.6–16.5

Precipitation117 mm/mo 83.3–126

Air humidity60.5 % 57.7–60.5

Moisture balance-17.0 mm/mo -57.3–-4.50

Vapour deficit835 Pa 762–1,039

Wind speed2.30 m/s 2.20–3.40

Cloud cover44.8 % 39.6–45.5

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)