Nemapogon geniculatella

(Dietz, 1905) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Nemapogon

At a glance

Occurrence records28

Data sources7

Biological traits0

DNA specimens26

eDNA detections36

Sources7 archives

Databases and archives Nemapogon geniculatella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF28 records

Environmental DNA1 datasets · 1 countries36 detections

DNA & barcodingBOLD26 specimens

01Narrative

Nemapogon geniculatella is a moth of the family Tineidae. It is found in North America, where it has been recorded from California, Oregon, Montana, and Utah.mothphotographersgroup

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nemapogon geniculatella has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes1

eDNA detections36

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

85Cmostly conserved

94Cmostly conserved

547Cmostly conserved

548Cmostly conserved

616Tmostly conserved

643Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCTAGAATAGTAGGTACCTCATTAAGAATTTTAATTCGAACAGAATTAAGAAGTCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.35%

Haplotypes8

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nemapogon hungaricussame genus6.3%Nemapogon cypricasame genus6.8%Nemapogon koenigisame genus7.1%Nemapogon wolffiellasame genus7.1%Nemapogon auropulvellasame genus7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type28 records

Wild obs. + sensor3

Museum / vouchered25

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	20
Smithsonian Institution, National Museum of Natural Historylocation not on record	3
Cambridge, US	1
Santa Cruz, US	1

4 institutions · 25 of 25 vouchered records shown

09Environmental DNA36 detections

Where the DNA of Nemapogon geniculatella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map1 country0

3. Shrubland | 3.4. Temperate ShrublandCreek bottom in oak-pinyon-juniper zone1. Forest & Woodland | 1.4. Temperate Forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 17.4–28.0

Seasonal swing summer↔winter17.6 °C

Max temp (day)32.7 °C 23.7–35.7

Min temp (night)18.0 °C 10.0–19.9

Precipitation4.20 mm/mo 2.00–37.9

Air humidity46.5 % 40.3–49.6

Moisture balance-161 mm/mo -184–-102

Vapour deficit1,741 Pa 1,128–2,113

Wind speed2.30 m/s 1.60–4.80

Cloud cover17.2 % 9.90–31.0

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)