Nemapogon acapnopennella

(Clemens, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Nemapogon

At a glance

Occurrence records29

Data sources7

Biological traits0

DNA specimens25

eDNA detections34

Sources7 archives

Databases and archives Nemapogon acapnopennella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility29 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF29 records

Environmental DNA1 datasets · 2 countries34 detections

DNA & barcodingBOLD25 specimens

01Narrative

Nemapogon acapnopennella, size: 6.3 mm Nemapogon acapnopennella is a moth of the family Tineidae. It is found in North America, where it has been recorded from Arkansas, British Columbia, the District of Columbia, Florida, Illinois, Indiana, Maine, Maryland, Mississippi, Ohio, Oklahoma, Ontario, Quebec, South Carolina, Tennessee and Texas.mothphotographersgroup The wingspan is about 9 mm. Adults have been recorded on wing from February to November.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nemapogon acapnopennella has left across the world's sequence archives.

At a glance

DNA specimens25

BINs2

Marker genes1

eDNA detections34

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

46Amostly conserved

220Tmostly conserved

334Gmostly conserved

401Tmostly conserved

553Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCTAGAATAATTGGTACATCATTAAGAATTTTAATTCGAACTGAATTAAGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes5

BINs2

Most divergent pair4.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nemapogon interstitiellasame genus4.0%Nemapogon auropulvellasame genus6.7%Nemapogon cypricasame genus6.7%Nemaxera betulinellasame family6.7%Archinemapogon yildizaesame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type29 records

Wild obs. + sensor15

Museum / vouchered14

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 10≤1 km 2≤10 km 1>10 km 1

14 georeferenced · 1 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	4
Washington, US	3
Cambridge, US	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
East Lansing, US	1

5 institutions · 10 of 14 vouchered records shown · 4 without an institution code

09Environmental DNA34 detections

Where the DNA of Nemapogon acapnopennella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map2 countries0

ForestAspen forest1. Forest & Woodland|1.1. Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.3 °C 3.20–23.6

Seasonal swing summer↔winter28.6 °C

Max temp (day)21.9 °C 8.00–27.4

Min temp (night)12.1 °C -1.10–18.8

Precipitation83.2 mm/mo 71.5–126

Air humidity58.2 % 55.0–60.7

Moisture balance-17.2 mm/mo -64.2–26.4

Vapour deficit770 Pa 348–1,222

Wind speed2.90 m/s 2.00–3.80

Cloud cover44.5 % 34.8–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)