Archinemapogon yildizae

Koçak, 1981 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Archinemapogon

At a glance

Occurrence records2 024

Data sources7

Biological traits0

DNA specimens28

eDNA detections41

Sources7 archives

Databases and archives Archinemapogon yildizae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 024 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 024 records

Environmental DNA3 datasets · 9 countries41 detections

DNA & barcodingBOLD28 specimens

01Narrative

Archinemapogon yildizae is a moth of the family Tineidae. It was described by Ahmet Ömer Koçak in 1981. It is found in most of Europe, except Ireland, the Benelux, the Iberian Peninsula and most of the Balkan Peninsula.Fauna Europaea The habitat consists of birch woodlands.Hants moths The wingspan is 14–21 mm. Adults are on wing from May to July. The larvae feed on bracket fungi (Fomes or Piptorus species) growing on Betula.UKMoths

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archinemapogon yildizae has left across the world's sequence archives.

At a glance

DNA specimens28

BINs1

Marker genes1

eDNA detections41

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

277Gmostly conserved

403Gmostly conserved

554Gmostly conserved

562Gmostly conserved

622Gmostly conserved

AACTTTATATTTTATTTTTGGAATCTGAGCTAGAATAATTGGTACATCACTAAGAATTTTAATTCGAACTGAATTAAGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes8

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nemapogon acapnopennellasame family7.0%Nemapogon interstitiellasame family7.6%Nemapogon fungivorellasame family8.5%Nemapogon robustasame family8.9%Nemapogon ophrionellasame family9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 024 records

Wild obs. + sensor1 762

Museum / vouchered262

Range

Area of Occupancy AOO4 020 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 740≤1 km 514≤10 km 460>10 km 3

1 717 georeferenced · 45 without coordinates

Open the mapobservation + sensor1 762

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 122≤1 km 86≤10 km 14

222 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence262

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	73
SLU Artdatabankenlocation not on record	43
Tartu, EE	25
Kuopio, FI	20
Stockholm, SE	13
DanishLepidopterologicalSocietylocation not on record	11
Rovaniemi, FI	6
Tromsø, NO	4
Metsähallituslocation not on record	3
NMBU:MINAlocation not on record	2
Provincia di Livornolocation not on record	2
Tallinn, EE	2
Cornell University Insect Collectionlocation not on record	2
Research Collection of Gerald Fuchslocation not on record	2
neflocation not on record	2
Salzburg, AT	1
ZSMlocation not on record	1
Philadelphia, US	1
NTNU-VMlocation not on record	1
Natural History Museum, Londonlocation not on record	1
MZLUlocation not on record	1
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	1

22 institutions · 217 of 262 vouchered records shown · 45 without an institution code

09Environmental DNA41 detections

Where the DNA of Archinemapogon yildizae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys3

Countries9

Verifiable raw sequence linked14

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map9 countries0

1.1. Boreal Forest|1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 7.50–16.9

Seasonal swing summer↔winter21.2 °C

Max temp (day)18.9 °C 11.7–20.7

Min temp (night)10.4 °C 2.90–12.9

Precipitation86.4 mm/mo 64.8–176

Air humidity59.5 % 57.4–63.3

Moisture balance-13.5 mm/mo -43.2–62.8

Vapour deficit693 Pa 423–776

Wind speed2.60 m/s 1.80–3.50

Cloud cover42.1 % 32.2–58.3

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Archinemapogon yildizae

At a glance

Sources7 archives

At a glance

Record type2 024 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 024 records