Nectopsyche pavida

(Hagen, 1861) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Trichoptera/Leptoceridae/Nectopsyche

At a glance

Occurrence records542

Data sources7

Biological traits0

DNA specimens27

eDNA detections10

Sources7 archives

Databases and archives Nectopsyche pavida's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility542 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF542 records

Environmental DNA1 datasets · 5 countries10 detections

DNA & barcodingBOLD27 specimens

01Narrative

Nectopsyche pavida is a species of long-horned caddisfly in the family Leptoceridae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nectopsyche pavida has left across the world's sequence archives.

At a glance

DNA specimens27

BINs6

Marker genes1

eDNA detections10

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 72% of positions are identical in every specimen.

Where individuals differ — all 181 variable positions, in barcode order

3Cmostly conserved

4Amostly conserved

5Cmostly conserved

7Tmostly conserved

16Amostly conserved

22Amostly conserved

23Gmostly conserved

24Cmostly conserved

25Tmostly conserved

29Gmostly conserved

31Tmostly conserved

34Tmostly conserved

37Amostly conserved

38Tmostly conserved

40Amostly conserved

43Tmostly conserved

46Tmostly conserved

56Gmostly conserved

58Tmostly conserved

59Tmostly conserved

61Amostly conserved

64Tmostly conserved

67Avariable

74Cmostly conserved

76Tmostly conserved

79Amostly conserved

82Tmostly conserved

83Amostly conserved

85Amostly conserved

86Cmostly conserved

88Amostly conserved

91Tmostly conserved

92Tmostly conserved

99Amostly conserved

112Tmostly conserved

121Cvariable

122Amostly conserved

127Tvariable

130Amostly conserved

133Tmostly conserved

142Tmostly conserved

143Amostly conserved

145Tmostly conserved

154Tmostly conserved

157Tmostly conserved

163Amostly conserved

169Amostly conserved

172Tmostly conserved

184Gvariable

190Amostly conserved

197Cmostly conserved

200Gvariable

201Tmostly conserved

202Cvariable

205Cmostly conserved

208Amostly conserved

212Cmostly conserved

214Tmostly conserved

216Amostly conserved

217Cvariable

218Tmostly conserved

220Amostly conserved

223Tmostly conserved

226Tmostly conserved

232Amostly conserved

235Cmostly conserved

241Cvariable

247Tmostly conserved

250Tmostly conserved

259Cmostly conserved

262Amostly conserved

263Cmostly conserved

265Tmostly conserved

271Tmostly conserved

274Tmostly conserved

277Amostly conserved

278Tmostly conserved

283Tmostly conserved

293Cmostly conserved

295Cmostly conserved

301Amostly conserved

302Tmostly conserved

304Amostly conserved

305Gmostly conserved

307Cvariable

310Amostly conserved

313Amostly conserved

316Gvariable

317Amostly conserved

319Tmostly conserved

322Gvariable

328Tmostly conserved

337Amostly conserved

339Amostly conserved

343Cmostly conserved

346Amostly conserved

347Tmostly conserved

352Tmostly conserved

354Amostly conserved

355Tmostly conserved

358Tmostly conserved

364Amostly conserved

371Gmostly conserved

379Tmostly conserved

382Amostly conserved

385Tmostly conserved

386Cmostly conserved

388Tmostly conserved

391Tmostly conserved

394Tmostly conserved

401Cmostly conserved

403Cvariable

406Tvariable

412Amostly conserved

415Tmostly conserved

418Cmostly conserved

421Cvariable

427Tmostly conserved

433Amostly conserved

436Amostly conserved

+61 more variable positions not shown

AACACTTTATTTTATATTTGGAGCTTGAGCTGGTTTATTAGGTACTTCTTTAAGAGTTTTAATTCGAACAGAACTTAGAACTACACAATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)7.4%

Haplotypes7

BINs6

Most divergent pair18.4%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nectopsyche cubanasame genus13.1%Nectopsyche candidasame genus13.5%Nectopsyche exquisitasame genus13.9%Nectopsyche ortizisame genus14.3%Nectopsyche gemmoidessame genus14.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type542 records

Wild obs. + sensor197

Museum / vouchered345

Range

Area of Occupancy AOO1 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 113≤1 km 40≤10 km 2>10 km 13

168 georeferenced · 29 without coordinates

Open the mapobservation + sensor197

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 22≤1 km 25≤10 km 51>10 km 1

99 georeferenced · 246 without coordinates

Open the institutions mapphysical evidence345

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	215
Champaign, US	97
Mexico City, MX	4
Smithsonian Institution, National Museum of Natural Historylocation not on record	4
Wuzhou, CN	2
Illinois Natural History Surveylocation not on record	2
Montréal, CA	2
New Haven, US	1
CUlocation not on record	1
University of Minnesota Insect Collectionlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
University Park, US	1

12 institutions · 331 of 345 vouchered records shown · 14 without an institution code

09Environmental DNA10 detections

Where the DNA of Nectopsyche pavida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.9 °C 19.2–25.0

Seasonal swing summer↔winter21.1 °C

Max temp (day)25.7 °C 24.1–29.0

Min temp (night)17.0 °C 14.5–21.0

Precipitation94.9 mm/mo 73.5–115

Air humidity59.9 % 57.8–64.9

Moisture balance-45.1 mm/mo -84.9–-19.4

Vapour deficit956 Pa 874–1,185

Wind speed2.70 m/s 1.30–3.40

Cloud cover38.5 % 24.0–44.8

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)