Nectopsyche candida

(Hagen, 1861) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Trichoptera/Leptoceridae/Nectopsyche

At a glance

Occurrence records1 469

Data sources7

Biological traits0

DNA specimens34

eDNA detections32

Sources7 archives

Databases and archives Nectopsyche candida's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 469 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 469 records

Environmental DNA1 datasets · 2 countries32 detections

DNA & barcodingBOLD34 specimens

01Narrative

Nectopsyche candida is a species of long-horned caddisfly in the family Leptoceridae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nectopsyche candida has left across the world's sequence archives.

At a glance

DNA specimens34

BINs2

Marker genes1

eDNA detections32

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

16Cmostly conserved

22Amostly conserved

34Amostly conserved

49Tvariable

208Gmostly conserved

217Gmostly conserved

232Tmostly conserved

241Amostly conserved

262Avariable

289Gvariable

313Amostly conserved

316Amostly conserved

334Gmostly conserved

343Cvariable

358Tmostly conserved

367Tmostly conserved

382Gmostly conserved

391Amostly conserved

439Tmostly conserved

499Tmostly conserved

533Tmostly conserved

568Tmostly conserved

613Cmostly conserved

616Cmostly conserved

625Amostly conserved

646Cmostly conserved

AACTTTATATTTTATCTTTGGAGTTTGATCTGGATTAATAGGAACTTCTTTAAGTTTATTAATTCGAACAGAACTTAGAACAACTCAATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes8

BINs2

Most divergent pair4.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nectopsyche exquisitasame genus7.3%Nectopsyche paludicolasame genus8.2%Nectopsyche gracilissame genus8.8%Nectopsyche tavarasame genus9.0%Nectopsyche albidasame genus9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 469 records

Wild obs. + sensor453

Museum / vouchered1 016

Range

Area of Occupancy AOO2 516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 218≤1 km 63≤10 km 7>10 km 61

349 georeferenced · 104 without coordinates

Open the mapobservation + sensor453

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 345≤1 km 249≤10 km 77>10 km 29

700 georeferenced · 316 without coordinates

Open the institutions mapphysical evidence1 016

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	702
St. Paul, US	205
Wuzhou, CN	69
Montréal, CA	4
Smithsonian Institution, National Museum of Natural Historylocation not on record	3
Mexico City, MX	2
Colorado State Universitylocation not on record	2
Chicago, US	2
CUlocation not on record	1
WIlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Illinois Natural History Surveylocation not on record	1
University Park, US	1

13 institutions · 994 of 1 016 vouchered records shown · 22 without an institution code

09Environmental DNA32 detections

Where the DNA of Nectopsyche candida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map2 countries0

Wetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.1 °C 19.2–25.2

Seasonal swing summer↔winter24.6 °C

Max temp (day)27.5 °C 24.2–30.2

Min temp (night)18.2 °C 15.1–20.9

Precipitation110 mm/mo 84.6–134

Air humidity59.2 % 57.6–60.7

Moisture balance-48.3 mm/mo -72.7–-18.2

Vapour deficit1,093 Pa 912–1,302

Wind speed2.90 m/s 1.70–4.70

Cloud cover36.9 % 30.7–42.2

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nectopsyche candida

At a glance

Sources7 archives

At a glance

Record type1 469 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 469 records