Nectopsyche exquisita

(Walker, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Trichoptera/Leptoceridae/Nectopsyche

At a glance

Occurrence records1 631

Data sources7

Biological traits0

DNA specimens39

eDNA detections36

Sources7 archives

Databases and archives Nectopsyche exquisita's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 631 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 631 records

Environmental DNA1 datasets · 2 countries36 detections

DNA & barcodingBOLD39 specimens

01Narrative

Nectopsyche exquisita is a species of long-horned caddisfly in the family Leptoceridae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nectopsyche exquisita has left across the world's sequence archives.

At a glance

DNA specimens39

BINs2

Marker genes2

eDNA detections36

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

13Amostly conserved

94Tmostly conserved

103Cvariable

145Amostly conserved

160Tmostly conserved

166Amostly conserved

187Amostly conserved

188Cmostly conserved

194Cmostly conserved

295Gmostly conserved

298Gmostly conserved

514Avariable

524Cvariable

529Cmostly conserved

547Amostly conserved

550Amostly conserved

652Tmostly conserved

CGGAGTTTGATCAGGTTTAATAGGTACTTCTTTAAGTTTATTAATTCGAACAGAATTAAGAACAACTCAATCTTTAATTAAAAATGATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes3

BINs2

Most divergent pair0.31%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nectopsyche candidasame genus7.3%Nectopsyche albidasame genus10.3%Nectopsyche paludicolasame genus10.3%Nectopsyche tavarasame genus10.9%Nectopsyche gracilissame genus11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCYTB

animal barcodemitochondrial

08Occurrence & distribution

Record type1 631 records

Wild obs. + sensor1 081

Museum / vouchered550

Range

Area of Occupancy AOO3 072 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 654≤1 km 141≤10 km 26>10 km 89

910 georeferenced · 171 without coordinates

Open the mapobservation + sensor1 081

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 40≤1 km 70≤10 km 180>10 km 1

291 georeferenced · 259 without coordinates

Open the institutions mapphysical evidence550

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	296
St. Paul, US	178
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
Wuzhou, CN	8
Montréal, CA	5
Smithsonian Institution, National Museum of Natural Historylocation not on record	4
Tempe, US	3
CUlocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Chicago, US	2
Centre for Biodiversity Genomicslocation not on record	2
Environment Canadalocation not on record	1
Georgia Museum of Natural Historylocation not on record	1
Lexington, US	1
Illinois Natural History Surveylocation not on record	1

15 institutions · 516 of 550 vouchered records shown · 34 without an institution code

09Environmental DNA36 detections

Where the DNA of Nectopsyche exquisita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map2 countries0

RiverForestUrbanTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 15.2–24.4

Seasonal swing summer↔winter28.0 °C

Max temp (day)23.4 °C 19.3–29.4

Min temp (night)14.2 °C 11.8–19.7

Precipitation103 mm/mo 84.3–103

Air humidity60.0 % 56.6–60.0

Moisture balance-22.1 mm/mo -65.5–-14.5

Vapour deficit831 Pa 696–1,239

Wind speed2.40 m/s 2.40–3.70

Cloud cover50.6 % 31.4–50.6

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nectopsyche exquisita

At a glance

Sources7 archives

At a glance

Record type1 631 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 631 records