Heriaeus oblongus

Simon, 1918 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Thomisidae/Heriaeus

At a glance

Occurrence records893

Data sources8

Biological traits14

DNA specimens6

eDNA detections1

Sources8 archives

Databases and archives Heriaeus oblongus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility893 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

World Spider Trait DBMasaryk University14 traits · 9 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements9 literature sources14 traits

Occurrence & distributionGBIF893 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD6 specimens

01Narrative

Heriaeus oblongus (лат.) — вид пауков семейства Пауки-бокоходы (Thomisidae). Встречается в Европе, на восток до Кавказа. Длина тела самок от 5,6 до 8 мм. Длина тела самцов от 4,5 до 6 мм. Эпигинум с большим копуляционным отверстием. Просома блестящая желтая до изумрудно-зеленой. Опистосома блестит желтым до изумрудно-зеленого, несёт 3 ярких полоски. У самцов удлинённая, почти вдвое длиннее своей ширины. На лугах, на траве и кустарниках, в степях и лесостепях, в сухих теплых местахПервые две пары ног развернуты передними поверхностями вверх, заметно длиннее ног третьей и четвёртой пар. Паутину не плетут, жертву ловят своими видоизменёнными передними ногами.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 9 sources

Macías-Hernández et al. 2020Entling et al. 2007Buchar & Růžička 2002Blick et al. 2016Noflatscher 1994Liste France 2018Řezáč et al. 2015Nentwig et al. 2018Cardoso et al. 2011

Morphometry6

Body length♀6.8·♂4.85 mm

Cephalothorax height♀0.68·♂0.86 mm

Cephalothorax length♀2.83·♂2.04 mm

Cephalothorax width♀2.67·♂1.91 mm

Fang length♀0.29·♂0.21 mm

Tibia I length♀3.08·♂3.81 mm

Predation1

Hunting guildambush hunters

Ecology7

Circadian activity0.67 mm

Light0.625 mm

Light 2open

Moisture 10.125 mm

Moisture 2very dry

Regional non-IUCN Red List categoryEndangered (2)

Stratum0.56 mm

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Heriaeus oblongus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

37Amostly conserved

169Tvariable

200Gmostly conserved

220Tmostly conserved

241Amostly conserved

316Gvariable

325Tvariable

331Gmostly conserved

337Gmostly conserved

340Cmostly conserved

343Tmostly conserved

358Gmostly conserved

373Amostly conserved

421Amostly conserved

433Amostly conserved

436Tmostly conserved

481Amostly conserved

484Tmostly conserved

499Amostly conserved

511Amostly conserved

517Amostly conserved

518Tmostly conserved

535Amostly conserved

541Amostly conserved

547Cmostly conserved

TACGTTATATCTATTATTTGGTGCTTGATCGGCTATAGTTGGGACTGCTATAAGAGTTTTGATTCGAATGGAATTAGGGAATTCTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes3

BIN1

Most divergent pair1.1%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Heriaeus hirtussame genus4.4%Thomisus spectabilissame family9.9%Synema imitatrixsame family10.3%Tmarus pigersame family10.8%Psammitis labradorensissame family10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type893 records

Wild obs. + sensor468

Museum / vouchered417

Other8

Origin

Native1

Range

Area of Occupancy AOO1 456 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 119≤1 km 54≤10 km 110>10 km 14

297 georeferenced · 171 without coordinates

Open the mapobservation + sensor468

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤1 km 15≤10 km 53

68 georeferenced · 349 without coordinates

Open the institutions mapphysical evidence417

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	327
Provincia di Livornolocation not on record	10
Ekaterinburg, RU	6
Prioksko-Terrasnyi Biosphere Reservelocation not on record	2
Bonn, DE	2
Ilia State Universitylocation not on record	1
Frankfurt am Main	1

7 institutions · 349 of 417 vouchered records shown · 68 without an institution code

09Environmental DNA1 detections

Where the DNA of Heriaeus oblongus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)