Psammitis labradorensis

(Keyserling, 1887) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Thomisidae/Psammitis

At a glance

Occurrence records4

Data sources8

Biological traits3

DNA specimens95

eDNA detections2

Sources8 archives

Databases and archives Psammitis labradorensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics95 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF4 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD95 specimens

01Narrative

Psammitis labradorensis is a species of crab spider in the family Thomisidae. It is found in North America and Greenland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1978

Morphometry3

Body length♀5·♂4.5 mm

Cephalothorax length♀2.17·♂2.14 mm

Cephalothorax width♀2.1·♂2.02 mm

05DNA & barcoding95 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psammitis labradorensis has left across the world's sequence archives.

At a glance

DNA specimens95

BINs1

Marker genes2

eDNA detections2

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus90 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

GACTTTATATTTATTATTTGGTGCTTGATCGGCTATAGTTGGTACTGCAATAAGAGTTTTAATTCGTATAGAGTTAGGAAATGTGGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.67%

Haplotypes3

BIN1

Most divergent pair19.5%

N.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Psammitis deichmannisame genus4.4%Spiracme striatipessame family8.4%Xysticus gallicussame family8.7%Xysticus ephippiatussame family9.0%Xysticus kochisame family9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type4 records

Wild obs. + sensor3

Museum / vouchered1

Range

Area of Occupancy AOO12 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Gujarat Biodiversity Gene Banklocation not on record	1

1 institutions · 1 of 1 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Psammitis labradorensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 18.8–18.8

Seasonal swing summer↔winter14.0 °C

Max temp (day)25.8 °C

Min temp (night)12.4 °C

Precipitation3.00 mm/mo

Air humidity46.1 %

Moisture balance-96.6 mm/mo

Vapour deficit1,166 Pa

Wind speed2.60 m/s

Cloud cover17.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)