Heriaeus hirtus

(Latreille, 1819) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Thomisidae/Heriaeus

At a glance

Occurrence records1 149

Data sources9

Biological traits4

DNA specimens7

eDNA detections24

Sources9 archives

Databases and archives Heriaeus hirtus's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 149 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

World Spider Trait DBMasaryk University4 traits · 5 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources4 traits

Occurrence & distributionGBIF1 149 records

Environmental DNA1 datasets · 2 countries24 detections

DNA & barcodingBOLD7 specimens

01Narrative

Heriaeus hirtus is a species of crab spiders belonging to the family Thomisidae.Catalogue of lifeWorld Spider Catalog Version 19.0

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014aGajdoš et al. 2014Gajdoš & Svatoň 2001Maelfait et al. 1998Noflatscher 1994

Ecology3

Circadian activitydiurnal

Regional IUCN Red List categoryNear Threatened (NT)

Regional non-IUCN Red List categoryRare geographically restricted species (RG)

Defence1

Primary defenceCrypsis

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Heriaeus hirtus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs3

Marker genes1

eDNA detections24

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Diversity (π)2.8%

Haplotypes1

BINs3

Where individuals differ — all 52 variable positions, in barcode order

4Avariable

7Amostly conserved

43Amostly conserved

61Gmostly conserved

67Amostly conserved

70Gmostly conserved

73Avariable

74Tvariable

76Amostly conserved

79Amostly conserved

88Tmostly conserved

94Gvariable

106Tvariable

112Amostly conserved

139Gmostly conserved

169Tmostly conserved

181Amostly conserved

193Tmostly conserved

202Tmostly conserved

205Tvariable

241Tmostly conserved

250Cmostly conserved

259Tmostly conserved

262Amostly conserved

266Tmostly conserved

268Amostly conserved

283Tvariable

289Amostly conserved

310Gmostly conserved

316Amostly conserved

319Amostly conserved

322Tmostly conserved

331Amostly conserved

337Amostly conserved

349Avariable

373Gmostly conserved

391Tmostly conserved

397Tmostly conserved

415Gmostly conserved

433Amostly conserved

484Tmostly conserved

493Amostly conserved

496Tvariable

502Avariable

511Gmostly conserved

520Gmostly conserved

544Avariable

556Amostly conserved

592Tmostly conserved

619Gmostly conserved

628Gvariable

631Avariable

TACATTATATTTATTATTTGGTGCTTGATCAGCTATAGTTGGAACTGCTATAAGAGTTTTGATTCGAATGGAATTAGGAAATTCTGGTAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Heriaeus oblongussame genus4.4%Thomisus spectabilissame family9.7%Oxytate ribessame family9.9%Oxytate striatipessame family10.2%Cupiennius chiapanensissame order10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 149 records

Wild obs. + sensor989

Museum / vouchered159

Other1

Range

Area of Occupancy AOO2 920 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 245≤1 km 145≤10 km 310>10 km 24

724 georeferenced · 265 without coordinates

Open the mapobservation + sensor989

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy1% within 1 km

≤1 km 1≤10 km 117>10 km 8

126 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence159

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	10
Helsinki, FI	3
Washington, US	3
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	3
Prioksko-Terrasnyi Biosphere Reservelocation not on record	2
	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1

8 institutions · 25 of 159 vouchered records shown · 131 without an institution code

09Environmental DNA24 detections

Where the DNA of Heriaeus hirtus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map2 countries0

GenevriersDry calcareous grasslandsMediterranean forestDiciduous forest (Fraxinus plantation)Bois de MontmaurOlive orchard

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 17.0–21.1

Seasonal swing summer↔winter17.2 °C

Max temp (day)25.8 °C 20.7–25.8

Min temp (night)15.2 °C 11.6–15.2

Precipitation40.1 mm/mo 40.1–58.7

Air humidity53.9 % 53.9–56.5

Moisture balance-122 mm/mo -122–-79.1

Vapour deficit1,155 Pa 839–1,155

Wind speed2.90 m/s 2.90–3.30

Cloud cover39.2 % 38.6–41.5

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Heriaeus hirtus

At a glance

Sources9 archives

Ecology3

Defence1

At a glance

Record type1 149 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 149 records