Hentzia grenada

(G.W.Peckham & E.G.Peckham, 1894) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Salticidae/Hentzia

At a glance

Occurrence records137

Data sources8

Biological traits0

DNA specimens8

eDNA detections8

Sources8 archives

Databases and archives Hentzia grenada's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility137 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF137 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Hentzia grenada is a species of jumping spider. It is found in Florida and south Georgia in the United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hentzia grenada has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.04%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

390Cmostly conserved

AACATTATATTTAATTTTTGGAGCTTGATCTGCTATAGTGGGTACAGCAATAAGAGTGTTGATTCGAATGGAATTAGGTCAAACTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hentzia mitratasame genus4.4%Hentzia palmarumsame genus4.6%Myrmapana parallelasame family9.7%Eris militarissame family10.0%Metacyrba punctatasame family10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type137 records

Wild obs. + sensor127

Museum / vouchered10

Range

Area of Occupancy AOO516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 68≤1 km 13≤10 km 4>10 km 17

102 georeferenced · 25 without coordinates

Open the mapobservation + sensor127

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6

6 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	6
Chicago, US	1
Frankfurt am Main	1

3 institutions · 8 of 10 vouchered records shown · 2 without an institution code

09Environmental DNA8 detections

Where the DNA of Hentzia grenada was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 19.1–25.8

Seasonal swing summer↔winter10.8 °C

Max temp (day)29.6 °C 24.6–31.0

Min temp (night)20.2 °C 14.6–22.4

Precipitation89.6 mm/mo 65.8–99.2

Air humidity58.2 % 56.9–59.4

Moisture balance-86.1 mm/mo -99.3–-23.1

Vapour deficit1,344 Pa 930–1,395

Wind speed3.10 m/s 2.60–3.70

Cloud cover29.8 % 27.8–36.3

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)