Hentzia mitrata

(Hentz, 1846) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Salticidae/Hentzia

At a glance

Occurrence records4 628

Data sources8

Biological traits0

DNA specimens106

eDNA detections4

Sources8 archives

Databases and archives Hentzia mitrata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 628 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics106 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 628 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD106 specimens

01Narrative

Hentzia mitrata, the white-jawed jumping spider, is a species of jumping spider in the family Salticidae. It is found in the United States, Canada, and Bahama Islands.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding106 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hentzia mitrata has left across the world's sequence archives.

At a glance

DNA specimens106

BINs2

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus97 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

11Cmostly conserved

58Gvariable

82Avariable

106Cmostly conserved

145Cmostly conserved

241Gmostly conserved

271Tvariable

302Amostly conserved

451Amostly conserved

616Tvariable

AACATTATATCTAATTTTTGGAGCTTGATCTGCTATAGTAGGTACAGCAATAAGAGTGTTAATTCGAATGGAATTAGGTCAAACTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.98%

Haplotypes30

BINs2

Most divergent pair3.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hentzia grenadasame genus4.4%Beata wickhamisame family10.2%Icius pulchellussame family10.3%Myrmarachne solitariasame family10.6%Telamonia dimidiatasame family10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 628 records

Wild obs. + sensor4 503

Museum / vouchered125

Range

Area of Occupancy AOO14 028 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 2 483≤1 km 542≤10 km 186>10 km 604

3 815 georeferenced · 688 without coordinates

Open the mapobservation + sensor4 503

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 5≤10 km 10>10 km 2

18 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	24
Ohio State University Acarology Laboratorylocation not on record	22
Chicago, US	12
Champaign, US	8
Royal Ontario Museumlocation not on record	7
Albuquerque, US	3
US	3
Cambridge, US	2
Denver, US	2
Chicago, US	2
Cincinnati, US	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1

12 institutions · 88 of 125 vouchered records shown · 37 without an institution code

09Environmental DNA4 detections

Where the DNA of Hentzia mitrata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

1. Forest & Woodlandon spruce

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 15.7–21.8

Seasonal swing summer↔winter24.8 °C

Max temp (day)21.8 °C 20.3–25.2

Min temp (night)14.8 °C 10.9–19.1

Precipitation96.2 mm/mo 81.8–107

Air humidity59.8 % 59.0–61.0

Moisture balance-30.8 mm/mo -49.9–-7.80

Vapour deficit822 Pa 734–1,021

Wind speed2.80 m/s 2.50–3.70

Cloud cover44.0 % 37.3–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hentzia mitrata

At a glance

Sources8 archives

At a glance

Record type4 628 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 628 records