Hentzia palmarum

(Hentz, 1832) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Salticidae/Hentzia

At a glance

Occurrence records4 040

Data sources9

Biological traits1

DNA specimens29

eDNA detections1

Sources9 archives

Databases and archives Hentzia palmarum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 040 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

World Spider Trait DBMasaryk University1 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF4 040 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD29 specimens

01Narrative

Hentzia palmarum, the common hentz jumper, is a species of jumping spider in the family Salticidae. It is found in North America, Bermuda, the Bahamas, and Cuba. They seem to have made it The Hawaiian Islands as well. Adult male face Adult female face Adult male dorsal Adult female dorsal

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár et al. 2012a

Predation1

Prey diversity1 mm

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hentzia palmarum has left across the world's sequence archives.

At a glance

DNA specimens29

BINs2

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

58Gvariable

82Gmostly conserved

109Cmostly conserved

145Cmostly conserved

181Amostly conserved

241Gmostly conserved

271Tmostly conserved

302Amostly conserved

352Tmostly conserved

364Tmostly conserved

430Gmostly conserved

544Amostly conserved

616Tvariable

628Amostly conserved

AACATTATATCTAATTTTTGGAGCTTGATCTGCTATAGTAGGTACAGCAATAAGAGTGTTAATTCGAATGGAATTAGGTCAGACTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.85%

Haplotypes8

BINs2

Most divergent pair2.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hentzia grenadasame genus4.6%Beata wickhamisame family10.3%Myrmaplata plataleoidessame family10.7%Myrmarachne solitariasame family10.8%Telamonia dimidiatasame family10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 040 records

Wild obs. + sensor3 873

Museum / vouchered166

Other1

Range

Area of Occupancy AOO11 908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 2 058≤1 km 401≤10 km 141>10 km 614

3 214 georeferenced · 659 without coordinates

Open the mapobservation + sensor3 873

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 1≤1 km 6≤10 km 20>10 km 4

31 georeferenced · 135 without coordinates

Open the institutions mapphysical evidence166

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ohio State University Acarology Laboratorylocation not on record	36
Cambridge, US	25
Denver, US	21
Champaign, US	16
Chicago, US	15
US	10
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
Centre for Biodiversity Genomicslocation not on record	6
Albuquerque, US	3
Sam Noble Oklahoma Museum of Natural Historylocation not on record	3
Texas A&M University Insect Collectionlocation not on record	2
Chicago, US	2
Cincinnati, US	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1

14 institutions · 150 of 166 vouchered records shown · 16 without an institution code

09Environmental DNA1 detections

Where the DNA of Hentzia palmarum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

shrub

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter27.5 °C

Max temp (day)18.1 °C

Min temp (night)13.1 °C

Precipitation91.1 mm/mo

Air humidity58.3 %

Moisture balance-46.8 mm/mo

Vapour deficit718 Pa

Wind speed4.30 m/s

Cloud cover43.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hentzia palmarum

At a glance

Sources9 archives

Predation1

At a glance

Record type4 040 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 040 records