Gonia capitata

(De Geer, 1776) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Gonia

At a glance

Occurrence records131

Data sources7

Biological traits0

DNA specimens16

eDNA detections10

Sources7 archives

Databases and archives Gonia capitata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility131 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF131 records

Environmental DNA1 datasets · 5 countries10 detections

DNA & barcodingBOLD16 specimens

01Narrative

Gonia capitata is a Palaearctic species of fly in the family Tachinidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gonia capitata has left across the world's sequence archives.

At a glance

DNA specimens16

BINs4

Marker genes1

eDNA detections10

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 68 variable positions, in barcode order

15Cmostly conserved

26Gmostly conserved

28Tmostly conserved

36Amostly conserved

48Cvariable

54Tmostly conserved

67Gmostly conserved

69Amostly conserved

81Tmostly conserved

84Amostly conserved

102Tmostly conserved

105Cvariable

111Cvariable

123Cvariable

129Cmostly conserved

135Tmostly conserved

142Amostly conserved

144Tmostly conserved

159Amostly conserved

180Amostly conserved

186Tmostly conserved

189Amostly conserved

195Gvariable

201Tmostly conserved

210Amostly conserved

219Tmostly conserved

231Tmostly conserved

234Cmostly conserved

237Cmostly conserved

246Tmostly conserved

262Cmostly conserved

264Tmostly conserved

289Tmostly conserved

297Cmostly conserved

299Gmostly conserved

303Amostly conserved

315Gmostly conserved

318Cvariable

321Gmostly conserved

334Gmostly conserved

342Tmostly conserved

345Cvariable

357Tmostly conserved

361Gmostly conserved

363Tmostly conserved

369Amostly conserved

375Cvariable

376Tmostly conserved

406Cvariable

415Gvariable

444Tmostly conserved

468Cvariable

474Cvariable

480Tmostly conserved

513Tvariable

526Gmostly conserved

528Tmostly conserved

561Amostly conserved

577Tmostly conserved

595Tmostly conserved

606Cvariable

615Cmostly conserved

630Amostly conserved

633Cmostly conserved

636Tmostly conserved

640Tmostly conserved

645Tvariable

651Tmostly conserved

ACATTATATTTTATCTTTGGAGCTTGATCAAGAATAATTGGAACTTCCTTAAGTATATTAATTCGAGTAGAATTAGGTCATCCAGGTTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.2%

Haplotypes7

BINs4

Most divergent pair6.3%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gonia contumaxsame genus4.7%Gonia divisasame genus4.9%Gonia frontosasame genus4.9%Gonia piceasame genus5.3%Gonia ornatasame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type131 records

Wild obs. + sensor81

Museum / vouchered42

Cultivated / captive5

Other3

Range

Area of Occupancy AOO284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 52≤1 km 14≤10 km 5>10 km 1

72 georeferenced · 9 without coordinates

Open the mapobservation + sensor81

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 1≤1 km 8≤10 km 24>10 km 1

34 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence42

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	26
Helsinki, FI	6
Durban Natural Science Museumlocation not on record	3
Uniwersytet Łódzkilocation not on record	2
Gothenburg, SE	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
NHMOlocation not on record	1
NCMGlocation not on record	1

8 institutions · 41 of 42 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Gonia capitata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map5 countries0

near fishing pondfloodplain of the Tisza

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 8.30–22.7

Seasonal swing summer↔winter22.0 °C

Max temp (day)21.1 °C 11.9–28.1

Min temp (night)12.4 °C 4.60–16.2

Precipitation53.2 mm/mo 42.5–75.5

Air humidity59.5 % 52.8–63.4

Moisture balance-34.3 mm/mo -110–-15.8

Vapour deficit778 Pa 471–1,307

Wind speed3.20 m/s 2.40–4.10

Cloud cover42.0 % 29.5–44.4

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)