Gonia frontosa

Say, 1829 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Gonia

At a glance

Occurrence records15

Data sources7

Biological traits0

DNA specimens15

eDNA detections8

Sources7 archives

Databases and archives Gonia frontosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD15 specimens

01Narrative

Gonia frontosa is a species of bristle fly in the family Tachinidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gonia frontosa has left across the world's sequence archives.

At a glance

DNA specimens15

BINs3

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

43Amostly conserved

49Avariable

64Tvariable

67Avariable

82Tvariable

106Tvariable

115Tvariable

133Tvariable

160Gvariable

181Tmostly conserved

187Cmostly conserved

193Cvariable

214Amostly conserved

220Tmostly conserved

235Tvariable

268Tmostly conserved

271Tvariable

281Avariable

298Cvariable

313Tvariable

337Tmostly conserved

340Tvariable

343Tvariable

349Avariable

373Avariable

376Cmostly conserved

386Tmostly conserved

406Tvariable

466Gvariable

505Tmostly conserved

526Avariable

538Tvariable

553Avariable

562Amostly conserved

565Avariable

616Cvariable

634Tmostly conserved

646Cvariable

AACATTATATTTTATTTTTGGAGCTTGATCAAGAATAATTGGAACTTCATTAAGTATATTAATTCGAGTAGAATTAGGTCATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes5

BINs3

Most divergent pair4.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gonia ornatasame genus2.4%Gonia divisasame genus2.9%Gonia sagaxsame genus3.3%Gonia piceasame genus3.6%Gonia contumaxsame genus3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type15 records

Wild obs. + sensor5

Museum / vouchered10

Range

Area of Occupancy AOO32 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 2

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 8

8 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	8
University of Guelphlocation not on record	1
CUlocation not on record	1

3 institutions · 10 of 10 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Gonia frontosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.20 °C 1.50–10.8

Seasonal swing summer↔winter30.5 °C

Max temp (day)11.7 °C 8.00–16.4

Min temp (night)-0.5 °C -4.90–5.30

Precipitation69.3 mm/mo 30.0–82.4

Air humidity55.0 % 52.0–55.4

Moisture balance-38.2 mm/mo -74.3–-10.3

Vapour deficit416 Pa 330–595

Wind speed3.80 m/s 2.10–4.90

Cloud cover43.1 % 39.8–49.5

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)