Gonia picea

(Robineau-Desvoidy, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Gonia

At a glance

Occurrence records1 436

Data sources7

Biological traits0

DNA specimens13

eDNA detections30

Sources7 archives

Databases and archives Gonia picea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 436 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 436 records

Environmental DNA4 datasets · 4 countries30 detections

DNA & barcodingBOLD13 specimens

01Narrative

Gonia picea is a Palaearctic species of fly in the family Tachinidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gonia picea has left across the world's sequence archives.

At a glance

DNA specimens13

BINs3

Marker genes1

eDNA detections30

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

5Tmostly conserved

22Amostly conserved

68Gmostly conserved

70Amostly conserved

82Cmostly conserved

85Avariable

106Tmostly conserved

130Tmostly conserved

145Tmostly conserved

160Avariable

184Tmostly conserved

187Cmostly conserved

190Amostly conserved

211Amostly conserved

220Amostly conserved

232Tmostly conserved

235Cmostly conserved

238Tmostly conserved

265Tmostly conserved

304Amostly conserved

305Gmostly conserved

322Amostly conserved

347Cmostly conserved

357Cvariable

358Tmostly conserved

364Amostly conserved

368Avariable

370Amostly conserved

373Amostly conserved

374Gmostly conserved

377Tmostly conserved

433Gvariable

529Tmostly conserved

562Avariable

596Tmostly conserved

631Amostly conserved

634Cmostly conserved

649Gvariable

652Tmostly conserved

653Cmostly conserved

AACATTATATTTTATTTTTGGAGCTTGAGCAAGAATAATTGGAACTTCTTTAAGTATATTAATTCGAGTAGAATTAGGTCACCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes6

BINs3

Most divergent pair2.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gonia contumaxsame genus3.5%Gonia ornatasame genus3.5%Gonia frontosasame genus3.6%Gonia distinguendasame genus4.3%Gonia smithisame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 436 records

Wild obs. + sensor1 323

Museum / vouchered113

Range

Area of Occupancy AOO3 648 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 734≤1 km 288≤10 km 174>10 km 5

1 201 georeferenced · 122 without coordinates

Open the mapobservation + sensor1 323

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 44≤1 km 55≤10 km 6

105 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence113

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	69
University of Tokyo, Department of Zoologylocation not on record	4
NHMOlocation not on record	3
CBDClocation not on record	2
Provincia di Livornolocation not on record	2
Tilburg, NL	2
ZMAAlocation not on record	2
South Kensington, GB	2
NMOKlocation not on record	2
Helsinki, FI	1
SGAV-and-NHMDlocation not on record	1
Philadelphia, US	1
neflocation not on record	1

13 institutions · 92 of 113 vouchered records shown · 21 without an institution code

09Environmental DNA30 detections

Where the DNA of Gonia picea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys4

Countries4

Verifiable raw sequence linked21

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.40 °C 5.20–10.7

Seasonal swing summer↔winter17.6 °C

Max temp (day)10.2 °C 9.80–14.9

Min temp (night)2.70 °C 1.40–5.20

Precipitation41.2 mm/mo 40.8–75.2

Air humidity60.6 % 57.6–61.5

Moisture balance-28.3 mm/mo -42.1–-14.6

Vapour deficit371 Pa 357–539

Wind speed4.00 m/s 2.40–4.40

Cloud cover45.1 % 41.1–51.3

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Gonia picea

At a glance

Sources7 archives

At a glance

Record type1 436 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 436 records