Gonepteryx farinosa

(Zeller, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Gonepteryx

At a glance

Occurrence records579

Data sources8

Biological traits0

DNA specimens28

eDNA detections184

Sources8 archives

Databases and archives Gonepteryx farinosa's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility579 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI184 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF579 records

Environmental DNA1 datasets · 15 countries184 detections

DNA & barcodingBOLD28 specimens

Genome at a glanceGoaT2n = 64

01Narrative

Gonepteryx farinosa , the Powdered Brimstone, is a butterfly found in the Palearctic that belongs to the whites family.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gonepteryx farinosa has left across the world's sequence archives.

At a glance

DNA specimens28

BINs2

Marker genes1

eDNA detections184

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

22Avariable

106Cmostly conserved

112Tmostly conserved

130Avariable

142Tmostly conserved

199Gvariable

205Tmostly conserved

220Tmostly conserved

235Tmostly conserved

266Cmostly conserved

271Cvariable

278Tmostly conserved

287Tmostly conserved

349Tvariable

400Cvariable

403Tvariable

490Tvariable

499Amostly conserved

601Tvariable

616Cvariable

619Avariable

631Avariable

634Cvariable

646Tvariable

TACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes7

BINs2

Most divergent pair3.3%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gonepteryx cleopatrasame genus1.5%Gonepteryx cleobulesame genus2.3%Gonepteryx maximasame genus2.4%Gonepteryx rhamnisame genus2.4%Gonepteryx aminthasame genus3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Gonepteryx farinosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 64 n = 32

Chromosome records32–642n range48median64mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 321×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 641×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type579 records

Wild obs. + sensor106

Museum / vouchered445

Cultivated / captive21

Other7

Range

Area of Occupancy AOO1 424 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 32≤1 km 27≤10 km 13>10 km 16

88 georeferenced · 18 without coordinates

Open the mapobservation + sensor106

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤100 m 1≤1 km 26≤10 km 395>10 km 6

428 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence445

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 21 records without

Open the mapnot free-living21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum Rotterdamlocation not on record	18
Tartu, EE	9
Cambridge, US	8
Zürich, CH	4
Philadelphia, US	2
Helsinki, FI	2
Haus der Natur, Salzburglocation not on record	2
Nijmegen, NL	1
NMOKlocation not on record	1
Research Collection of Stefano Berettalocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

11 institutions · 49 of 445 vouchered records shown · 396 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA184 detections

Where the DNA of Gonepteryx farinosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found184

Studies independent surveys1

Countries15

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 184 detections have coordinates

Open the map15 countries0

MeadowUrban pine forestDry acidic grasslands

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 12.8–23.9

Seasonal swing summer↔winter15.8 °C

Max temp (day)23.0 °C 16.4–28.1

Min temp (night)15.8 °C 8.00–20.8

Precipitation32.0 mm/mo 8.20–66.8

Air humidity57.5 % 49.7–64.1

Moisture balance-102 mm/mo

Vapour deficit957 Pa 651–1,323

Wind speed3.40 m/s

Cloud cover34.9 % 19.5–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 180 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)