Gonepteryx amintha

(Blanchard, 1871) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Gonepteryx

At a glance

Occurrence records116

Data sources7

Biological traits0

DNA specimens30

eDNA detections21

Sources7 archives

Databases and archives Gonepteryx amintha's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility116 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF116 records

Environmental DNA1 datasets · 2 countries21 detections

DNA & barcodingBOLD30 specimens

01Narrative

Gonepteryx amintha is a butterfly of the family Pieridae. It is found in the East Palearctic.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gonepteryx amintha has left across the world's sequence archives.

At a glance

DNA specimens30

BINs3

Marker genes1

eDNA detections21

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

1Tvariable

59Cmostly conserved

79Tmostly conserved

82Tmostly conserved

88Tmostly conserved

100Tmostly conserved

106Cmostly conserved

115Tmostly conserved

127Tvariable

136Cmostly conserved

184Amostly conserved

193Tmostly conserved

220Tvariable

367Cmostly conserved

385Tmostly conserved

403Cmostly conserved

466Amostly conserved

478Tmostly conserved

514Tmostly conserved

523Tvariable

562Amostly conserved

625Amostly conserved

646Tmostly conserved

TACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTAATTCGAACAGAATTAGGTAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes9

BINs3

Most divergent pair2.3%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gonepteryx maximasame genus2.6%Gonepteryx maderensissame genus2.9%Gonepteryx farinosasame genus3.0%Gonepteryx cleopatrasame genus3.0%Gonepteryx cleobulesame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_079672 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrn16rrn12

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type116 records

Wild obs. + sensor73

Museum / vouchered41

Other2

Range

Area of Occupancy AOO372 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 17≤1 km 21≤10 km 4>10 km 12

54 georeferenced · 19 without coordinates

Open the mapobservation + sensor73

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤100 m 2≤10 km 19>10 km 16

37 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence41

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	19
Cambridge, US	8
Zürich, CH	8
Auckland, NZ	4
Natural History Museum Rotterdamlocation not on record	2

5 institutions · 41 of 41 vouchered records shown

09Environmental DNA21 detections

Where the DNA of Gonepteryx amintha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 17.5–23.1

Seasonal swing summer↔winter17.9 °C

Max temp (day)24.1 °C 19.9–25.8

Min temp (night)17.3 °C 13.1–18.9

Precipitation275 mm/mo 189–397

Air humidity70.1 % 61.9–70.8

Moisture balance153 mm/mo 53.6–288

Vapour deficit777 Pa 608–959

Wind speed3.00 m/s 1.20–3.40

Cloud cover47.2 % 30.6–56.5

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)