Gonepteryx cleopatra

(Linnaeus, 1767) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Gonepteryx

At a glance

Occurrence records77 514

Data sources9

Biological traits2

DNA specimens173

eDNA detections13

Sources9 archives

Databases and archives Gonepteryx cleopatra's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility77 514 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics173 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF77 514 records

Environmental DNA1 datasets · 3 countries13 detections

DNA & barcodingBOLD173 specimens

Genome at a glanceGoaT · NCBI≈1 Mbp

01Narrative

Gonepteryx cleopatra, the Cleopatra or Cleopatra butterfly, is a medium-sized butterfly of the family Pieridae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding173 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gonepteryx cleopatra has left across the world's sequence archives.

At a glance

DNA specimens173

BINs2

Marker genes1

eDNA detections13

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus170 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

64Tmostly conserved

100Amostly conserved

136Tmostly conserved

220Tmostly conserved

340Tmostly conserved

349Cmostly conserved

358Tmostly conserved

367Tmostly conserved

400Cmostly conserved

421Cmostly conserved

490Cmostly conserved

578Cmostly conserved

TACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.38%

Haplotypes7

BINs2

Most divergent pair2.1%

EuropeAsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gonepteryx farinosasame genus1.5%Gonepteryx cleobulesame genus2.3%Gonepteryx maximasame genus2.7%Gonepteryx rhamnisame genus3.0%Gonepteryx aminthasame genus3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Gonepteryx cleopatra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 419 660 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Gonepteryx cleopatra0.0014 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

08Occurrence & distribution

Record type77 514 records

Wild obs. + sensor75 342

Museum / vouchered1 659

Cultivated / captive484

Other29

Origin

Native595

Range

Area of Occupancy AOO71 100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 19 122≤1 km 11 172≤10 km 19 006>10 km 637

49 937 georeferenced · 25 405 without coordinates

Open the mapobservation + sensor75 342

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 12≤1 km 239≤10 km 386>10 km 67

704 georeferenced · 955 without coordinates

Open the institutions mapphysical evidence1 659

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 484 records without

Open the mapnot free-living484

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UMUlocation not on record	691
Natural History Museum Rotterdamlocation not on record	219
Zürich, CH	121
Helsinki, FI	65
Edmonton, CA	37
Cambridge, US	34
New Haven, US	30
NMOKlocation not on record	19
Banyoles, ES	18
Tartu, EE	14
Nijmegen, NL	13
Cleveland Museum of Natural History, OH (CLEV)location not on record	12
IMEDEAlocation not on record	8
Durban Natural Science Museumlocation not on record	7
UVEG-ENVlocation not on record	7
Museu Nacional de História Natural e da Ciêncialocation not on record	5
South Kensington, GB	4
MZLUlocation not on record	4
European Distributed Institute of Taxonomy (EDIT)location not on record	4
Brussels, BE	4
Bern, CH	4
Provincia di Livornolocation not on record	4
John May Museum of Natural Historylocation not on record	3
Uniwersytet Łódzkilocation not on record	3
ZSMlocation not on record	3
RBINS-Scientific Heritagelocation not on record	3
Toronto, CA	2
Natural History Museum of Utahlocation not on record	2
NHMOlocation not on record	2
Salzburg, AT	2
Geneva, CH	2
ZMAAlocation not on record	2
Santa Barbara Museum of Natural Historylocation not on record	1
Cornell University Insect Collectionlocation not on record	1
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

37 institutions · 1 353 of 1 659 vouchered records shown · 306 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA13 detections

Where the DNA of Gonepteryx cleopatra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 11.4–24.7

Seasonal swing summer↔winter16.7 °C

Max temp (day)22.2 °C 16.4–31.4

Min temp (night)16.0 °C 6.10–18.6

Precipitation29.3 mm/mo 0.4–80.1

Air humidity52.5 % 48.4–58.8

Moisture balance-73.5 mm/mo -197–-29.3

Vapour deficit1,001 Pa 637–1,604

Wind speed3.50 m/s 1.90–3.80

Cloud cover26.1 % 6.20–36.3

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Gonepteryx cleopatra

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type77 514 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 37 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type77 514 records