Euxoa pluralis

Grote, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records325

Data sources7

Biological traits0

DNA specimens8

eDNA detections9

Sources7 archives

Databases and archives Euxoa pluralis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility325 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF325 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD8 specimens

01Narrative

Euxoa pluralis is a species of moth of the family Noctuidae. It is found from British Columbia, south to Nevada and California. The wingspan is about 34 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa pluralis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.04%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

49Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCCTTAAGATTATTAATCCGAGCTGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa catenulasame genus2.4%Euxoa dodisame genus2.7%Euxoa inconcinnasame genus2.7%Euxoa infractasame genus2.9%Euxoa albipennissame genus3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type325 records

Wild obs. + sensor81

Museum / vouchered244

Range

Area of Occupancy AOO596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy45% within 1 km

≤100 m 21≤1 km 4≤10 km 15>10 km 16

56 georeferenced · 25 without coordinates

Open the mapobservation + sensor81

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 25≤1 km 7≤10 km 22>10 km 30

84 georeferenced · 160 without coordinates

Open the institutions mapphysical evidence244

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	75
Oregon State Arthropod Collectionlocation not on record	49
University of Alberta Museums (UAM)location not on record	38
East Lansing, US	26
Vernal, US	19
Cleveland Museum of Natural History, OH (CLEV)location not on record	12
New Haven, US	10
Denver, US	4
San Diego, US	3
ASUlocation not on record	3
WWUlocation not on record	2
Helsinki, FI	1

12 institutions · 242 of 244 vouchered records shown · 2 without an institution code

09Environmental DNA9 detections

Where the DNA of Euxoa pluralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 13.7–17.1

Seasonal swing summer↔winter21.3 °C

Max temp (day)22.3 °C 21.2–24.5

Min temp (night)8.90 °C 6.20–10.3

Precipitation22.7 mm/mo 13.6–37.8

Air humidity44.8 % 41.1–49.6

Moisture balance-143 mm/mo -146–-106

Vapour deficit971 Pa 885–1,099

Wind speed2.50 m/s 1.70–3.30

Cloud cover12.8 % 12.2–25.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)