Euxoa albipennis

Grote, 1876 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records615

Data sources7

Biological traits0

DNA specimens22

eDNA detections23

Sources7 archives

Databases and archives Euxoa albipennis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility615 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF615 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD22 specimens

01Narrative

Euxoa albipennis is a moth of the family Noctuidae first described by Augustus Radcliffe Grote in 1876. It is found from coast to coast in southern Canada and the northern parts of the United States, ranging southward in the west to New Mexico, Arizona and California. The wingspan is 30–35 mm. Larvae have been reported from Oxytropis, Lupinus, Melilotus, Helianthus, Solanum tuberosum and Zea mays.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa albipennis has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

82Tmostly conserved

112Tmostly conserved

184Amostly conserved

187Tvariable

220Tmostly conserved

340Cvariable

412Tmostly conserved

451Tmostly conserved

520Gmostly conserved

562Tmostly conserved

616Cmostly conserved

622Avariable

628Avariable

631Tmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.83%

Haplotypes8

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa plagigerasame genus2.6%Euxoa cinereopallidussame genus2.7%Euxoa cicatricosasame genus2.9%Euxoa atristrigatasame genus2.9%Euxoa henriettasame genus3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type615 records

Wild obs. + sensor190

Museum / vouchered425

Range

Area of Occupancy AOO1 208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 108≤1 km 20≤10 km 19>10 km 16

163 georeferenced · 27 without coordinates

Open the mapobservation + sensor190

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 39≤1 km 62≤10 km 51>10 km 14

166 georeferenced · 259 without coordinates

Open the institutions mapphysical evidence425

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	129
East Lansing, US	77
Colorado State Universitylocation not on record	41
St. Paul, US	41
Oregon State Arthropod Collectionlocation not on record	28
New Haven, US	27
Royal Saskatchewan Museumlocation not on record	15
Vernal, US	12
Helsinki, FI	10
San Diego, US	5
WWUlocation not on record	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Essig Museum of Entomologylocation not on record	4
Cambridge, US	3
Philadelphia, US	2
Natural History Museum of Utahlocation not on record	2
Denver, US	1
München, DE	1
US	1
Centre for Biodiversity Genomicslocation not on record	1

20 institutions · 409 of 425 vouchered records shown · 16 without an institution code

09Environmental DNA23 detections

Where the DNA of Euxoa albipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

4. Native Grassland4. Native Grassland | 4.4. Temperate Grassland1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C -1.40–20.7

Seasonal swing summer↔winter24.9 °C

Max temp (day)22.9 °C 2.70–28.0

Min temp (night)10.1 °C -5.30–14.5

Precipitation28.6 mm/mo 21.9–48.6

Air humidity52.7 % 48.6–61.8

Moisture balance-50.2 mm/mo -106–19.1

Vapour deficit841 Pa 217–1,178

Wind speed2.10 m/s 1.80–2.70

Cloud cover34.4 % 32.6–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)