Euxoa inconcinna

Harvey, 1875 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records208

Data sources5

Biological traits0

DNA specimens14

eDNA detections16

Sources5 archives

Databases and archives Euxoa inconcinna's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility208 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF208 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD14 specimens

01Narrative

Euxoa inconcinna is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Euxoa inconcinna is 10732.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa inconcinna has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections16

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

193Cmostly conserved

202Tmostly conserved

379Tmostly conserved

400Tmostly conserved

436Cvariable

589Tmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes6

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa terrealissame genus1.7%Euxoa catenulasame genus2.0%Euxoa auxiliarissame genus2.0%Euxoa temerasame genus2.1%Euxoa cinnabarinasame genus2.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type208 records

Wild obs. + sensor29

Museum / vouchered179

Range

Area of Occupancy AOO360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 12≤1 km 4≤10 km 8>10 km 2

26 georeferenced · 3 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 21≤1 km 71≤10 km 34>10 km 25

151 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence179

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	72
Colorado State Universitylocation not on record	28
US	21
East Lansing, US	12
New Haven, US	8
Ciudad de México, MX	8
St. Paul, US	5
Washington, US	4
RBINS-Scientific Heritagelocation not on record	2
Oregon State Arthropod Collectionlocation not on record	2
Brussels, BE	2
Denver, US	1
University of Alberta Museums (UAM)location not on record	1
Albuquerque, US	1

14 institutions · 167 of 179 vouchered records shown · 12 without an institution code

09Environmental DNA16 detections

Where the DNA of Euxoa inconcinna was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.6 °C 13.5–23.7

Seasonal swing summer↔winter18.8 °C

Max temp (day)26.2 °C 20.7–29.8

Min temp (night)12.1 °C 7.20–16.9

Precipitation56.5 mm/mo 8.10–119

Air humidity49.6 % 37.0–53.8

Moisture balance-61.9 mm/mo -155–-30.7

Vapour deficit1,038 Pa 804–1,602

Wind speed2.10 m/s 1.70–3.30

Cloud cover22.0 % 18.4–31.1

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)