Eustala emertoni

(Banks, 1904) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Eustala

At a glance

Occurrence records99

Data sources8

Biological traits0

DNA specimens42

eDNA detections42

Sources8 archives

Databases and archives Eustala emertoni's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility99 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF99 records

Environmental DNA1 datasets · 2 countries42 detections

DNA & barcodingBOLD42 specimens

01Narrative

Eustala emertoni is a species of orb weaver in the spider family Araneidae. It is found in the United States and Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eustala emertoni has left across the world's sequence archives.

At a glance

DNA specimens42

BINs1

Marker genes1

eDNA detections42

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

88Gmostly conserved

103Cmostly conserved

124Tmostly conserved

130Cmostly conserved

247Tmostly conserved

265Cmostly conserved

268Cmostly conserved

271Tmostly conserved

284Cmostly conserved

319Gmostly conserved

349Tmostly conserved

412Amostly conserved

424Cmostly conserved

433Tmostly conserved

451Tmostly conserved

475Amostly conserved

523Tmostly conserved

532Amostly conserved

541Amostly conserved

613Tmostly conserved

616Cvariable

634Cmostly conserved

TTTATATTTATTATTTGGGGCTTGAGCTGCTATAGTGGGGACAGCTATAAGAGTATTAATTCGAATTGAGTTAGGTCAACCTGGGAGGTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes10

BIN1

Most divergent pair2.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eustala cepinasame genus7.2%Eustala anasterasame genus8.1%Eustala rosaesame genus11.0%Neoscona subfuscasame family11.3%Cyclosa insulanasame family11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type99 records

Wild obs. + sensor8

Museum / vouchered91

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 4≤1 km 3>10 km 1

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1≤10 km 1

3 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence91

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	18
University of Guelph, Centre for Biodiversity Genomicslocation not on record	17
College Station, US	13
Chicago, US	9
Biodiversity Institute of Ontariolocation not on record	3
Ohio State University Acarology Laboratorylocation not on record	3
Cambridge, US	2
Centre for Biodiversity Genomicslocation not on record	1

8 institutions · 66 of 91 vouchered records shown · 25 without an institution code

09Environmental DNA42 detections

Where the DNA of Eustala emertoni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map2 countries0

GrasslandMixed habitatFreeman's MapleRiparian ZoneBeachForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 12.1–22.2

Seasonal swing summer↔winter26.4 °C

Max temp (day)23.9 °C 15.2–26.7

Min temp (night)15.7 °C 7.80–19.1

Precipitation87.9 mm/mo 79.1–120

Air humidity59.1 % 56.3–63.3

Moisture balance-50.9 mm/mo -64.2–21.7

Vapour deficit910 Pa 557–1,088

Wind speed2.90 m/s 2.20–4.10

Cloud cover39.7 % 36.0–52.1

CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)