Eustala anastera

(Walckenaer, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Eustala

At a glance

Occurrence records1 511

Data sources9

Biological traits3

DNA specimens108

eDNA detections69

Sources9 archives

Databases and archives Eustala anastera's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 511 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI69 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics108 specimens↗

World Spider Trait DBMasaryk University3 traits · 2 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~1.44 Gbp↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF1 511 records

Environmental DNA1 datasets · 2 countries69 detections

DNA & barcodingBOLD108 specimens

Genome at a glanceGoaT1.4 Gbp

01Narrative

Eustala anastera, the humpbacked orbweaver, is a species of orb weaver in the family Araneidae. It is found in North and Central America.Dean DA (2016). "Catalogue of Texas spiders". ZooKeys 570: 1-703.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGenaro & Alayón 1994Pekár 2014a

Ecology1

Circadian activitynocturnal

Defence2

PredatorTrypoxylon subimpressum

Primary defenceCrypsis

05DNA & barcoding108 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eustala anastera has left across the world's sequence archives.

At a glance

DNA specimens108

BINs4

Marker genes1

eDNA detections69

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus99 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 57 variable positions, in barcode order

1Avariable

4Tmostly conserved

13Avariable

14Amostly conserved

22Avariable

49Tvariable

73Gvariable

83Cmostly conserved

88Avariable

100Gmostly conserved

106Tmostly conserved

124Tvariable

127Avariable

136Cvariable

145Gvariable

175Gmostly conserved

196Gvariable

199Gvariable

217Tvariable

263Tmostly conserved

268Tmostly conserved

271Cvariable

292Cvariable

304Amostly conserved

322Gmostly conserved

334Avariable

361Gmostly conserved

367Cvariable

373Cmostly conserved

391Tmostly conserved

415Gmostly conserved

418Tmostly conserved

424Avariable

430Amostly conserved

445Tmostly conserved

466Amostly conserved

472Gmostly conserved

487Gmostly conserved

508Tvariable

511Gvariable

520Avariable

541Gvariable

571Tmostly conserved

574Tvariable

578Cvariable

589Cvariable

592Tvariable

595Tmostly conserved

604Tmostly conserved

616Tvariable

625Amostly conserved

631Gmostly conserved

637Amostly conserved

640Tvariable

646Tmostly conserved

649Gvariable

655Gmostly conserved

AACTTTATATTTAATATTTGGAGCTTGAGCTGCTATAGTAGGAACAGCTATAAGAGTATTAATTCGAATTGAGTTAGGTCAACCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.6%

Haplotypes22

BINs4

Most divergent pair8.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eustala cepinasame genus7.2%Eustala emertonisame genus8.1%Eustala rosaesame genus11.0%Eustala californiensissame genus11.1%Eriophora edaxsame family11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Eustala anastera carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 437 660 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Eustala anastera1.44 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type1 511 records

Wild obs. + sensor1 274

Museum / vouchered236

Other1

Origin

Native1

Range

Area of Occupancy AOO4 916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 669≤1 km 167≤10 km 48>10 km 166

1 050 georeferenced · 224 without coordinates

Open the mapobservation + sensor1 274

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 3≤1 km 12≤10 km 40>10 km 6

61 georeferenced · 175 without coordinates

Open the institutions mapphysical evidence236

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	38
Ohio State University Acarology Laboratorylocation not on record	34
Cambridge, US	22
University of Guelph, Centre for Biodiversity Genomicslocation not on record	17
Chicago, US	16
Champaign, US	13
College Station, US	12
San Francisco, US	6
US	6
Royal Ontario Museumlocation not on record	5
Albuquerque, US	4
Biodiversity Institute of Ontariolocation not on record	4
Sam Noble Oklahoma Museum of Natural Historylocation not on record	4
Chicago, US	3
Museo Nacional de Historia Natural "Prof. Eugenio de Jesús Marcano"location not on record	3
Cincinnati, US	2
Tapachula, MX	1
Buenos Aires, AR	1
Tartu, EE	1
Los Angeles, US	1
Centre for Biodiversity Genomicslocation not on record	1
Royal Saskatchewan Museumlocation not on record	1
Frankfurt am Main	1

23 institutions · 196 of 236 vouchered records shown · 40 without an institution code

09Environmental DNA69 detections

Where the DNA of Eustala anastera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found69

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 69 detections have coordinates

Open the map2 countries0

Foreston snowUrbangrass sweepprairieon maple

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 8.60–22.2

Seasonal swing summer↔winter26.4 °C

Max temp (day)24.2 °C 13.5–26.8

Min temp (night)14.9 °C 5.60–18.6

Precipitation89.0 mm/mo 75.6–110

Air humidity58.9 % 56.8–61.2

Moisture balance-53.5 mm/mo -67.9–-2.50

Vapour deficit929 Pa 459–1,124

Wind speed3.60 m/s 2.80–5.10

Cloud cover40.2 % 36.1–48.9

CHELSA 1981–2010, ~9 km grid, at location & month of 69 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eustala anastera

At a glance

Sources9 archives

Ecology1

Defence2

At a glance

Genome sizehow big the whole instruction manual is

Record type1 511 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 511 records