Eustala cepina

(Walckenaer, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Eustala

At a glance

Occurrence records102

Data sources9

Biological traits2

DNA specimens71

eDNA detections70

Sources9 archives

Databases and archives Eustala cepina's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility102 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI70 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics71 specimens↗

World Spider Trait DBMasaryk University2 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF102 records

Environmental DNA1 datasets · 2 countries70 detections

DNA & barcodingBOLD71 specimens

01Narrative

Eustala cepina is a species of orb weaver in the family of spiders known as Araneidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014a

Ecology1

Circadian activitynocturnal

Defence1

Primary defenceCrypsis

05DNA & barcoding71 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eustala cepina has left across the world's sequence archives.

At a glance

DNA specimens71

BINs1

Marker genes1

eDNA detections70

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus66 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

76Gmostly conserved

79Tmostly conserved

190Amostly conserved

430Avariable

GACTCTATATTTGTTATTTGGGGCATGAGCTGCTATAGTAGGGACAGCTATAAGAGTATTAATTCGAATTGAGTTGGGTCAACCTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.70%

Haplotypes16

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eustala anasterasame genus7.2%Eustala emertonisame genus7.2%Neoscona subfuscasame family10.7%Eustala rosaesame genus10.8%Eriophora edaxsame family11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type102 records

Wild obs. + sensor10

Museum / vouchered92

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 4≤1 km 2>10 km 3

9 georeferenced · 1 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤1 km 9≤10 km 6>10 km 4

19 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence92

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ohio State University Acarology Laboratorylocation not on record	16
Chicago, US	13
University of Guelph, Centre for Biodiversity Genomicslocation not on record	12
Cambridge, US	11
Champaign, US	8
Denver, US	7
College Station, US	3
Biodiversity Institute of Ontariolocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Royal Ontario Museumlocation not on record	1

10 institutions · 73 of 92 vouchered records shown · 19 without an institution code

09Environmental DNA70 detections

Where the DNA of Eustala cepina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found70

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 70 detections have coordinates

Open the map2 countries0

Riparian ZoneGrasslandMixed habitatWetlandMeadowlong grass and marsh habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 15.5–28.0

Seasonal swing summer↔winter25.8 °C

Max temp (day)26.6 °C 18.8–33.0

Min temp (night)19.4 °C 13.4–24.2

Precipitation88.2 mm/mo 74.3–125

Air humidity57.9 % 55.2–59.4

Moisture balance-82.6 mm/mo -127–-22.8

Vapour deficit1,109 Pa 732–1,696

Wind speed4.00 m/s 3.60–6.20

Cloud cover38.3 % 27.3–45.7

CHELSA 1981–2010, ~9 km grid, at location & month of 70 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)