Euschistus tristigmus

(Say, 1832) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Euschistus

At a glance

Occurrence records2 024

Data sources7

Biological traits0

DNA specimens271

eDNA detections275

Sources7 archives

Databases and archives Euschistus tristigmus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility2 024 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI275 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics271 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 024 records

Environmental DNA1 datasets · 2 countries275 detections

DNA & barcodingBOLD271 specimens

Genome at a glanceGoaT2n = 14

01Narrative

Euschistus tristigmus, the dusky stink bug, is a species of stink bug in the family Pentatomidae. It is found in Central America and North America. Dusky stink bug, Euschistus tristigmus

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding271 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euschistus tristigmus has left across the world's sequence archives.

At a glance

DNA specimens271

BINs3

Marker genes1

eDNA detections275

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P568 bp consensus255 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 53 variable positions, in barcode order

10Gvariable

31Amostly conserved

112Amostly conserved

115Amostly conserved

116Cmostly conserved

145Tmostly conserved

151Amostly conserved

160Tmostly conserved

169Cmostly conserved

176Tmostly conserved

181Tvariable

184Tmostly conserved

193Tmostly conserved

208Cmostly conserved

212Cvariable

214Gvariable

229Tmostly conserved

235Cmostly conserved

238Tmostly conserved

244Cmostly conserved

250Cmostly conserved

253Tmostly conserved

256Cmostly conserved

269Tmostly conserved

301Tmostly conserved

310Cmostly conserved

311Tmostly conserved

328Tmostly conserved

338Cmostly conserved

379Gvariable

385Gmostly conserved

388Gmostly conserved

409Cmostly conserved

418Cmostly conserved

433Cmostly conserved

442Amostly conserved

443Tmostly conserved

449Cmostly conserved

457Cmostly conserved

469Amostly conserved

488Cvariable

490Gvariable

496Cmostly conserved

499Tmostly conserved

502Tmostly conserved

511Tmostly conserved

526Cmostly conserved

538Amostly conserved

541Gmostly conserved

544Tmostly conserved

559Gmostly conserved

562Tmostly conserved

563Tvariable

ATTTATTGGGGATGATCAAATCTATAATGTAGTAGTTACTGCTCACGCATTCGTTATAATTTTTTTTATAGTAATACCAATTATAATTGG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes31

BINs3

Most divergent pair8.6%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euschistus conspersussame genus10.7%Euschistus ictericussame genus12.3%Euschistus servussame genus12.3%Euschistus variolariussame genus13.2%Eurydema dominulussame family13.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Euschistus tristigmus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type2 024 records

Wild obs. + sensor1 402

Museum / vouchered622

Range

Area of Occupancy AOO5 392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 780≤1 km 203≤10 km 51>10 km 129

1 163 georeferenced · 239 without coordinates

Open the mapobservation + sensor1 402

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 4≤1 km 23≤10 km 59>10 km 12

98 georeferenced · 524 without coordinates

Open the institutions mapphysical evidence622

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provo, US	112
Mississippi State, US	106
Chicago, US	90
College Station, US	24
University Park, US	24
St. Paul, US	19
Royal Saskatchewan Museumlocation not on record	17
University of Central Floridalocation not on record	15
Cambridge, US	7
OSUClocation not on record	7
Lubbock, US	5
Instituto de Fitosanidad, Colegio de Postgraduados, Campus Montecillolocation not on record	4
New Haven, US	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
CUlocation not on record	1
MX	1
Cornell University Insect Collectionlocation not on record	1
Agriculture and Agri-Food Canada, Southern Crop Protection and Food Research Centrelocation not on record	1

19 institutions · 442 of 622 vouchered records shown · 180 without an institution code

09Environmental DNA275 detections

Where the DNA of Euschistus tristigmus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found275

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 275 detections have coordinates

Open the map2 countries0

farm1. Forest & WoodlandMixed habitatMixed HabitatSphagnum bog14. Artificial - Terrestrial | 14.2 Pasturel…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.7 °C 15.5–21.9

Seasonal swing summer↔winter26.2 °C

Max temp (day)23.7 °C 20.9–26.2

Min temp (night)15.6 °C 11.4–20.0

Precipitation82.9 mm/mo 77.0–98.7

Air humidity58.1 % 56.6–60.3

Moisture balance-67.3 mm/mo -86.7–-26.2

Vapour deficit923 Pa 693–1,090

Wind speed3.30 m/s 2.80–4.00

Cloud cover39.2 % 37.3–44.5

CHELSA 1981–2010, ~9 km grid, at location & month of 261 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euschistus tristigmus

At a glance

Sources7 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 024 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 024 records