Euschistus servus

(Say, 1832) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Euschistus

At a glance

Occurrence records2 480

Data sources7

Biological traits0

DNA specimens141

eDNA detections205

Sources7 archives

Databases and archives Euschistus servus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility2 480 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI205 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics141 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 480 records

Environmental DNA1 datasets · 2 countries205 detections

DNA & barcodingBOLD141 specimens

Genome at a glanceGoaT2n = 14

01Narrative

Euschistus servus, the brown stink bug, is a species of stink bug in the family Pentatomidae. It is found in Central America and North America. Brown stink bug, Euschistus servus

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding141 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euschistus servus has left across the world's sequence archives.

At a glance

DNA specimens141

BINs1

Marker genes1

eDNA detections205

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P568 bp consensus126 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

7Tmostly conserved

10Gmostly conserved

100Tmostly conserved

173Cmostly conserved

214Gmostly conserved

223Avariable

247Cmostly conserved

250Cvariable

313Amostly conserved

358Cmostly conserved

376Amostly conserved

430Gmostly conserved

452Cmostly conserved

488Cmostly conserved

538Gmostly conserved

550Tmostly conserved

ATTTATTGGGGATGACCAAATCTATAATGTAGTAGTCACCGCTCACGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.89%

Haplotypes22

BIN1

Most divergent pair2.5%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euschistus variolariussame genus4.4%Euschistus ictericussame genus7.0%Euschistus conspersussame genus9.3%Euschistus tristigmussame genus12.3%Eurydema geblerisame family13.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Euschistus servus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type2 480 records

Wild obs. + sensor1 387

Museum / vouchered1 093

Range

Area of Occupancy AOO6 220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 759≤1 km 200≤10 km 43>10 km 105

1 107 georeferenced · 280 without coordinates

Open the mapobservation + sensor1 387

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 7≤1 km 27≤10 km 144>10 km 51

229 georeferenced · 864 without coordinates

Open the institutions mapphysical evidence1 093

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
North Carolina State University Insect Museumlocation not on record	288
Mississippi State, US	240
Provo, US	225
Chicago, US	65
Royal Saskatchewan Museumlocation not on record	29
College Station, US	25
New Haven, US	23
Sam Noble Oklahoma Museum of Natural Historylocation not on record	18
University of Central Floridalocation not on record	17
St. Paul, US	7
Montgomery, US	5
US	5
Mexico City, MX	4
Cambridge, US	4
Wuzhou, CN	3
Lubbock, US	2
ASUlocation not on record	2
CUlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
University of Guelphlocation not on record	1
MX	1
Chicago, US	1
Espace pour la vielocation not on record	1
Universidad Católica de Manizaleslocation not on record	1
Saint John, CA	1
University of Alabamalocation not on record	1

26 institutions · 973 of 1 093 vouchered records shown · 120 without an institution code

09Environmental DNA205 detections

Where the DNA of Euschistus servus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found205

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 205 detections have coordinates

Open the map2 countries0

ForestMeadowGrassTemperate mixed forest4. Native Grassland | 4.4. Temperate GrasslandGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 15.1–22.0

Seasonal swing summer↔winter26.4 °C

Max temp (day)24.9 °C 20.4–26.8

Min temp (night)16.1 °C 10.8–18.0

Precipitation89.5 mm/mo 73.9–98.7

Air humidity57.2 % 56.2–59.8

Moisture balance-61.7 mm/mo -80.5–-25.6

Vapour deficit963 Pa 692–1,133

Wind speed3.40 m/s 2.80–4.10

Cloud cover39.1 % 37.2–47.6

CHELSA 1981–2010, ~9 km grid, at location & month of 186 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euschistus servus

At a glance

Sources7 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 480 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 480 records