Euschistus variolarius

(Palisot, 1817) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Euschistus

At a glance

Occurrence records1 470

Data sources7

Biological traits0

DNA specimens104

eDNA detections93

Sources7 archives

Databases and archives Euschistus variolarius's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 470 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI93 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics104 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 470 records

Environmental DNA1 datasets · 2 countries93 detections

DNA & barcodingBOLD104 specimens

Genome at a glanceGoaT2n = 14

01Narrative

Euschistus variolarius, the one-spotted stink bug, is a species of stink bug in the family Pentatomidae. It is found in the Caribbean Sea and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding104 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euschistus variolarius has left across the world's sequence archives.

At a glance

DNA specimens104

BINs2

Marker genes2

eDNA detections93

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P627 bp consensus95 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

12Amostly conserved

43Cmostly conserved

69Amostly conserved

75Tmostly conserved

126Cmostly conserved

135Gmostly conserved

150Amostly conserved

186Gvariable

210Tmostly conserved

232Tmostly conserved

273Amostly conserved

306Tmostly conserved

309Tmostly conserved

312Tmostly conserved

321Tmostly conserved

330Gmostly conserved

396Tmostly conserved

402Amostly conserved

432Cmostly conserved

447Tmostly conserved

489Amostly conserved

492Tmostly conserved

495Amostly conserved

537Cmostly conserved

540Tmostly conserved

547Tmostly conserved

585Tmostly conserved

594Gmostly conserved

597Amostly conserved

610Cmostly conserved

GGTATAGTAGGATCCGCCATAAGAATCATCATTCGTATTGAACTAGGACAACCAGGAAGATTTATTGGAGATGATCAAATCTATAATGTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes13

BINs2

Most divergent pair4.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euschistus servussame genus4.4%Euschistus ictericussame genus6.7%Euschistus conspersussame genus8.9%Eurydema geblerisame family12.9%Glaucias subpunctatussame family12.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Euschistus variolarius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type1 470 records

Wild obs. + sensor293

Museum / vouchered1 177

Range

Area of Occupancy AOO2 740 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 155≤1 km 33≤10 km 17>10 km 55

260 georeferenced · 33 without coordinates

Open the mapobservation + sensor293

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 10≤1 km 92≤10 km 324>10 km 51

477 georeferenced · 700 without coordinates

Open the institutions mapphysical evidence1 177

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	302
Chicago, US	235
St. Paul, US	144
Provo, US	143
North Carolina State University Insect Museumlocation not on record	87
Natural History Museum of Utahlocation not on record	45
University of Guelphlocation not on record	32
University of Alberta Museums (UAM)location not on record	26
Mississippi State, US	25
Wuzhou, CN	23
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
Sam Noble Oklahoma Museum of Natural Historylocation not on record	9
University of Central Floridalocation not on record	5
College Station, US	4
Universidad Católica de Manizaleslocation not on record	3
Cambridge, US	2
University Park, US	1
Centre for Biodiversity Genomicslocation not on record	1
Toronto, CA	1
CUlocation not on record	1
Lubbock, US	1
OSUClocation not on record	1
Denver, US	1

23 institutions · 1 101 of 1 177 vouchered records shown · 76 without an institution code

09Environmental DNA93 detections

Where the DNA of Euschistus variolarius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found93

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 93 detections have coordinates

Open the map2 countries0

Hay FieldTemperate mixed forestMixed habitat14. Artificial - Terrestrial | 14.2 Pasturel…GrasslandMixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 14.8–23.5

Seasonal swing summer↔winter26.3 °C

Max temp (day)26.0 °C 20.1–26.1

Min temp (night)17.9 °C 11.5–21.0

Precipitation94.2 mm/mo 77.2–99.9

Air humidity57.5 % 56.9–60.5

Moisture balance-75.2 mm/mo -97.2–-4.80

Vapour deficit1,100 Pa 662–1,217

Wind speed3.60 m/s 2.80–5.70

Cloud cover37.9 % 36.5–47.1

CHELSA 1981–2010, ~9 km grid, at location & month of 86 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euschistus variolarius

At a glance

Sources7 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 470 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 470 records