Eriocrania sangii

(Wood, 1891) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Eriocraniidae/Eriocrania

At a glance

Occurrence records1 658

Data sources7

Biological traits2

DNA specimens149

eDNA detections178

Sources7 archives

Databases and archives Eriocrania sangii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 658 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI178 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics149 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 658 records

Environmental DNA4 datasets · 10 countries178 detections

DNA & barcodingBOLD149 specimens

01Narrative

Eriocrania sangii, the large birch purple, is a moth of the family Eriocraniidae found in Europe andDEFAULTSORT described by John Henry Wood in 1891. The moth can be found flying in sunshine around birch trees and the larvae feed on birch leaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding149 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eriocrania sangii has left across the world's sequence archives.

At a glance

DNA specimens149

BINs1

Marker genes2

eDNA detections178

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus136 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

88Amostly conserved

265Amostly conserved

316Gvariable

547Gmostly conserved

616Tvariable

628Gvariable

AACTTTATATTTTATTTTTGGTATTTGATCAGGGATAGTAGGAACTTCTTTAAGAATCTTAATTCGCTCAGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 43 variants.

Diversity (π)0.43%

Haplotypes43

BIN1

Most divergent pair1.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eriocrania semipurpurellasame genus7.3%Eriocrania sparrmannellasame genus9.0%Eriocraniella longifurculasame family9.0%Dyseriocrania griseocapitellasame family9.6%Dyseriocrania auricyaneasame family10.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 658 records

Wild obs. + sensor1 250

Museum / vouchered407

Other1

Range

Area of Occupancy AOO3 312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 407≤1 km 301≤10 km 518>10 km 2

1 228 georeferenced · 22 without coordinates

Open the mapobservation + sensor1 250

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 105≤1 km 85≤10 km 19

209 georeferenced · 198 without coordinates

Open the institutions mapphysical evidence407

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	77
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	40
Tartu, EE	16
SLU Artdatabankenlocation not on record	16
DanishLepidopterologicalSocietylocation not on record	14
ZMAAlocation not on record	6
Rovaniemi, FI	5
RMZlocation not on record	3
Stockholm, SE	3
Research Collection of Kai Berggrenlocation not on record	3
NTNU-VMlocation not on record	2
Oulu, FI	2
Research Collection of Juerg Schmidlocation not on record	2
University of Oulu, Zoological Museumlocation not on record	2
neflocation not on record	2
South Kensington, GB	2
Salzburg, AT	1
Nijmegen, NL	1
University of Oslo, Natural History Museumlocation not on record	1
Tilburg, NL	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Natural History Museum, Londonlocation not on record	1

22 institutions · 201 of 407 vouchered records shown · 206 without an institution code

09Environmental DNA178 detections

Where the DNA of Eriocrania sangii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found178

Studies independent surveys4

Countries10

Verifiable raw sequence linked35

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 178 detections have coordinates

Open the map10 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median3.70 °C -4.30–9.30

Seasonal swing summer↔winter20.6 °C

Max temp (day)6.20 °C -2.10–13.4

Min temp (night)-0.4 °C -7.20–5.00

Precipitation61.3 mm/mo 40.0–116

Air humidity62.7 % 56.8–72.7

Moisture balance21.8 mm/mo -41.0–53.5

Vapour deficit307 Pa 130–498

Wind speed3.70 m/s 2.50–5.20

Cloud cover51.7 % 42.1–56.7

CHELSA 1981–2010, ~9 km grid, at location & month of 175 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eriocrania sangii

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 658 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 658 records