Doriopsilla gemela

Gosliner, Schaefer & Millen, 1999 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Dendrodorididae/Doriopsilla

At a glance

Occurrence records1 271

Data sources8

Biological traits4

DNA specimens11

eDNA detections11

Sources8 archives

Databases and archives Doriopsilla gemela's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 248 records↗

OBISOcean Biodiversity Information System23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS1 271 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD11 specimens

01Narrative

Doriopsilla gemela is a species of dorid nudibranch, a colourful sea slug, a shell-less marine gastropod mollusk in the family Dendrodorididae.Bouchet, P. (2015). Doriopsilla gemela Gosliner, Schaefer & Millen, 1999. In: MolluscaBase (2015). Accessed through: World Register of Marine Species on 2016-12-14. There are five other species that are quite similar to this species and can be confused with it, and they are: Doriopsilla albopunctata (Cooper, 1863), Doriopsilla bertschi Hoover, Lindsay, Goddard & Valdés, 2015, Doriopsilla davebehrensi Hoover, Lindsay, Goddard & Valdés, 2015, Doriopsilla fulva (MacFarland, 1905) and Baptodoris mimetica Gosliner, 1991.Hoover C., Lindsay T., Goddard J.H.R. & Valdés A. (2015). Seeing double: pseudocryptic diversity in the Doriopsilla albopunctata–Doriopsilla gemela species complex of the north-eastern Pacific. Zoologica Scripta. 44: 612-631.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length4 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Vulnerability10

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Doriopsilla gemela has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

58Amostly conserved

84Cmostly conserved

88Tmostly conserved

118Tmostly conserved

125Gmostly conserved

157Cmostly conserved

169Cmostly conserved

184Gmostly conserved

187Cmostly conserved

208Amostly conserved

280Tmostly conserved

289Gmostly conserved

292Amostly conserved

301Tmostly conserved

370Tmostly conserved

382Tmostly conserved

425Cmostly conserved

427Amostly conserved

473Cmostly conserved

478Tmostly conserved

502Amostly conserved

535Amostly conserved

542Cmostly conserved

550Amostly conserved

598Cvariable

607Cmostly conserved

614Gmostly conserved

616Cmostly conserved

622Cmostly conserved

625Tmostly conserved

628Tmostly conserved

631Tmostly conserved

643Amostly conserved

AACATTATATGTCATTTTTGGTATATGATGTGGACTACTTGGAACAGGATTAAGATTATTAATTCGTTTTGAGTTGGGAACTGCTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes10

BIN1

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Doriopsilla bertschisame genus10.3%Doriopsilla davebehrensisame genus14.4%Doriopsilla miniatasame genus14.8%Doriopsilla fulvasame genus15.0%Doriopsilla areolatasame genus16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 271 records

Wild obs. + sensor1 221

Museum / vouchered50

Range

Area of Occupancy AOO860 km²

Depth

0–200 m sunlit5

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 6.1 m · max 18.3 m · 5 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 617≤1 km 299≤10 km 78>10 km 155

1 149 georeferenced · 72 without coordinates

Open the mapobservation + sensor1 221

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 4≤1 km 26≤10 km 16

46 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	22
San Francisco, US	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1

3 institutions · 27 of 50 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Doriopsilla gemela was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Doriopsilla gemela

At a glance

Sources8 archives

Size & morphology1

Habitat & environment2

Other traits1

At a glance

Record type1 271 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 3 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 271 records