Doriopsilla miniata

(Alder & Hancock, 1864) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Dendrodorididae/Doriopsilla

At a glance

Occurrence records423

Data sources8

Biological traits4

DNA specimens6

eDNA detections5

Sources8 archives

Databases and archives Doriopsilla miniata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility314 records↗

OBISOcean Biodiversity Information System109 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS423 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD6 specimens

01Narrative

The scribbled nudibranch (Doriopsilla miniata) is a species of sea slug, a dorid nudibranch. It is a marine gastropod mollusc in the family Dendrodorididae.Bouchet, P. (2010). Doriopsilla miniata (Alder & Hancock, 1864). Accessed through: World Register of Marine Species on 2012-06-09

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits2

Depth max30 m

Depth min0 m

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Doriopsilla miniata has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes2

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 54 variable positions, in barcode order

7Gmostly conserved

22Amostly conserved

37Tmostly conserved

64Tmostly conserved

85Gmostly conserved

88Gmostly conserved

103Tmostly conserved

109Tmostly conserved

121Amostly conserved

136Tmostly conserved

157Tmostly conserved

181Amostly conserved

187Tmostly conserved

193Tmostly conserved

208Amostly conserved

217Tmostly conserved

265Amostly conserved

268Tmostly conserved

274Amostly conserved

277Amostly conserved

283Cmostly conserved

289Gmostly conserved

322Amostly conserved

357Gmostly conserved

364Amostly conserved

373Amostly conserved

412Gmostly conserved

415Gmostly conserved

418Tmostly conserved

427Amostly conserved

428Tmostly conserved

437Amostly conserved

448Cmostly conserved

487Gmostly conserved

502Gmostly conserved

514Amostly conserved

523Amostly conserved

526Tmostly conserved

547Tmostly conserved

550Gmostly conserved

557Tmostly conserved

577Amostly conserved

586Tmostly conserved

592Gmostly conserved

595Tmostly conserved

601Tmostly conserved

607Amostly conserved

622Tmostly conserved

625Amostly conserved

628Gmostly conserved

631Amostly conserved

634Cmostly conserved

646Cmostly conserved

655Amostly conserved

TACATTGTATGTAATTTTTGGAATATGGTGTGGACTTTTAGGAACTGGTTTAAGATTATTAATTCGTTTTGAATTGGGGACAGCGGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes3

BINs2

Most divergent pair8.2%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Doriopsilla pelseneerisame genus6.1%Doriopsilla areolatasame genus6.3%Doto cuspidatasame order15.7%Berthellina edwardsiisame order15.9%Doto fragilissame order15.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type423 records

Wild obs. + sensor356

Museum / vouchered66

Other1

Range

Area of Occupancy AOO636 km²

Depth

0–200 m sunlit48

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5.8 m · max 32.5 m · 48 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 147≤1 km 77≤10 km 73>10 km 8

305 georeferenced · 51 without coordinates

Open the mapobservation + sensor356

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 4≤1 km 25≤10 km 4

33 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence66

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	10
Sydney, AU	10
CASlocation not on record	8
National Marine Biodiversity Institute of Korealocation not on record	4
Western Australian Museumlocation not on record	3
ELMClocation not on record	2
Museum and Art Gallery of the Northern Territorylocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1

8 institutions · 39 of 66 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Doriopsilla miniata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)