Doriopsilla areolata

Bergh, 1880 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Dendrodorididae/Doriopsilla

At a glance

Occurrence records471

Data sources9

Biological traits2

DNA specimens5

eDNA detections0

Sources9 archives

Databases and archives Doriopsilla areolata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility454 records↗

OBISOcean Biodiversity Information System17 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS40 compounds

Occurrence & distributionGBIF · OBIS471 records

DNA & barcodingBOLD5 specimens

01Narrative

Doriopsilla areolata is a species of dorid nudibranch, a colourful sea slug, a shell-less marine gastropod mollusc in the family Dendrodorididae.MolluscaBase (2018). Doriopsilla areolata Bergh, 1880. Accessed on 2018-03-23.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

03Chemical composition40 compounds

Compounds documented for Doriopsilla areolata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Abietane diterpenoids15

Abietane diterpenoids $ Tetracyclic diterpenoids3

Clovane sesquiterpenoids2

Spongiane diterpenoids2

Icetexane diterpenoids2

Documented compounds40 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Caryophyllene	present	NPASS
(10S)-12-Methoxy-9,10-seco-9,20-cycloabieta-8,11,13-triene-10,11-diol	present	NPASS
(1R,11S)-5-methoxy-12,12-dimethyl-6-propan-2-yltricyclo[9.4.0.03,8]pentadeca-3,5,7-triene-1,4-diol	present	NPASS
(1R,8S,10S)-3,4-Dihydroxy-5-[(2R)-1-hydroxypropan-2-yl]-11,11-dimethyl-16-oxatetracyclo[6.6.2.01,10.02,7]hexadeca-2,4,6-trien-15-one	present	NPASS
(1R,8S,10S)-4-methoxy-11,11-dimethyl-5-propan-2-yl-16-oxatetracyclo[6.6.2.01,10.02,7]hexadeca-2,4,6-trien-3-ol	present	NPASS
(1S,2S,5R,8R,9R)-4,4,8-trimethyltricyclo[6.3.1.01,5]dodecane-2,9-diol	present	NPASS
(4aR,10aS)-5-acetyloxy-6-hydroxy-1,1-dimethyl-7-propan-2-yl-2,3,4,9,10,10a-hexahydrophenanthrene-4a-carboxylic acid	present	NPASS
(5aR,9aR)-4,5a-dihydroxy-6,6,9a-trimethyl-3-propan-2-yl-8,9-dihydro-7H-dibenzofuran-1-carboxylic acid	present	NPASS
(5aR,9aR)-6,6,9a-trimethyl-4,5,5a,7,8,9-hexahydrobenzo[g][1]benzofuran	present	LOTUS
(5aS,9aR)-6,6,9a-trimethyl-4,5,5a,7,8,9-hexahydrobenzo[e][2]benzofuran	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Doriopsilla areolata has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Diversity (π)4.2%

Haplotypes2

BINs2

Most divergent pair5.9%

Where individuals differ — all 49 variable positions, in barcode order

31Tvariable

38Cvariable

43Gvariable

79Gvariable

91Cvariable

103Tvariable

154Cvariable

166Avariable

184Avariable

196Gvariable

209Cvariable

229Amostly conserved

233Tmostly conserved

234Tmostly conserved

259Tmostly conserved

268Tmostly conserved

277Tmostly conserved

283Tmostly conserved

289Gmostly conserved

302Cmostly conserved

304Avariable

358Tmostly conserved

364Cvariable

367Tmostly conserved

373Amostly conserved

376Tmostly conserved

382Avariable

385Tmostly conserved

394Tmostly conserved

400Tmostly conserved

463Cvariable

469Amostly conserved

478Tmostly conserved

487Avariable

496Amostly conserved

499Gmostly conserved

523Amostly conserved

539Tmostly conserved

541Gmostly conserved

553Tmostly conserved

580Cvariable

583Avariable

601Tmostly conserved

628Amostly conserved

631Gmostly conserved

634Tmostly conserved

643Gmostly conserved

646Cmostly conserved

653Cmostly conserved

TACATTATATGTAATTTTTGGGATATGGTGTGGGCTTCTAGGGACTGGTTTAAGATTATTAATTCGTTTTGAATTGGGGACAGCGGGGAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Doriopsilla miniatasame genus6.3%Hypselodoris infucatasame order15.7%Doto cuspidatasame order15.7%Doriopsilla bertschisame genus15.8%Doto fragilissame order15.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type471 records

Wild obs. + sensor406

Museum / vouchered24

Other41

Range

Area of Occupancy AOO508 km²

Depth

0–200 m sunlit11

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 10.2 m · max 102 m · 11 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 126≤1 km 68≤10 km 73>10 km 4

271 georeferenced · 135 without coordinates

Open the mapobservation + sensor406

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 2≤1 km 14≤10 km 2>10 km 2

20 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	10
Museo Nacional de Ciencias Naturales (CSIC)location not on record	2
Paris, FR	1
Los Angeles, US	1

4 institutions · 14 of 24 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)